ID: 1007744393

View in Genome Browser
Species Human (GRCh38)
Location 6:44034555-44034577
Sequence GAATTGCAACAGCTGGCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007744387_1007744393 5 Left 1007744387 6:44034527-44034549 CCGGATGCAGGGGGTGGACCAGA No data
Right 1007744393 6:44034555-44034577 GAATTGCAACAGCTGGCCACGGG No data
1007744385_1007744393 9 Left 1007744385 6:44034523-44034545 CCTCCCGGATGCAGGGGGTGGAC No data
Right 1007744393 6:44034555-44034577 GAATTGCAACAGCTGGCCACGGG No data
1007744386_1007744393 6 Left 1007744386 6:44034526-44034548 CCCGGATGCAGGGGGTGGACCAG No data
Right 1007744393 6:44034555-44034577 GAATTGCAACAGCTGGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007744393 Original CRISPR GAATTGCAACAGCTGGCCAC GGG Intergenic
No off target data available for this crispr