ID: 1007744979

View in Genome Browser
Species Human (GRCh38)
Location 6:44038243-44038265
Sequence CTAGCCTAAGTGGTTCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007744974_1007744979 3 Left 1007744974 6:44038217-44038239 CCATGGGTAGAAATCCTAGGTGT No data
Right 1007744979 6:44038243-44038265 CTAGCCTAAGTGGTTCAAGGAGG No data
1007744970_1007744979 22 Left 1007744970 6:44038198-44038220 CCGCAAAGTCAGAGGAGGGCCAT No data
Right 1007744979 6:44038243-44038265 CTAGCCTAAGTGGTTCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007744979 Original CRISPR CTAGCCTAAGTGGTTCAAGG AGG Intergenic
No off target data available for this crispr