ID: 1007745470

View in Genome Browser
Species Human (GRCh38)
Location 6:44040576-44040598
Sequence TACCCAGGGAAGCTACTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007745457_1007745470 27 Left 1007745457 6:44040526-44040548 CCTCCTTCAGATGCCCATAAAGA No data
Right 1007745470 6:44040576-44040598 TACCCAGGGAAGCTACTGACTGG No data
1007745463_1007745470 13 Left 1007745463 6:44040540-44040562 CCATAAAGAGGGCAGGCATACCC No data
Right 1007745470 6:44040576-44040598 TACCCAGGGAAGCTACTGACTGG No data
1007745466_1007745470 -7 Left 1007745466 6:44040560-44040582 CCCAGTCTGGCTCAGGTACCCAG No data
Right 1007745470 6:44040576-44040598 TACCCAGGGAAGCTACTGACTGG No data
1007745462_1007745470 14 Left 1007745462 6:44040539-44040561 CCCATAAAGAGGGCAGGCATACC No data
Right 1007745470 6:44040576-44040598 TACCCAGGGAAGCTACTGACTGG No data
1007745459_1007745470 24 Left 1007745459 6:44040529-44040551 CCTTCAGATGCCCATAAAGAGGG No data
Right 1007745470 6:44040576-44040598 TACCCAGGGAAGCTACTGACTGG No data
1007745467_1007745470 -8 Left 1007745467 6:44040561-44040583 CCAGTCTGGCTCAGGTACCCAGG No data
Right 1007745470 6:44040576-44040598 TACCCAGGGAAGCTACTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007745470 Original CRISPR TACCCAGGGAAGCTACTGAC TGG Intergenic
No off target data available for this crispr