ID: 1007745780

View in Genome Browser
Species Human (GRCh38)
Location 6:44042289-44042311
Sequence CTTGAAGTTCAGAGGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007745780_1007745790 29 Left 1007745780 6:44042289-44042311 CCAGGTTCCCTCTGAACTTCAAG No data
Right 1007745790 6:44042341-44042363 CCAGCCCACACCTGCTACAAAGG No data
1007745780_1007745785 -1 Left 1007745780 6:44042289-44042311 CCAGGTTCCCTCTGAACTTCAAG No data
Right 1007745785 6:44042311-44042333 GGCAAGGAAGTCTTCTTCTATGG No data
1007745780_1007745786 4 Left 1007745780 6:44042289-44042311 CCAGGTTCCCTCTGAACTTCAAG No data
Right 1007745786 6:44042316-44042338 GGAAGTCTTCTTCTATGGTCAGG No data
1007745780_1007745787 5 Left 1007745780 6:44042289-44042311 CCAGGTTCCCTCTGAACTTCAAG No data
Right 1007745787 6:44042317-44042339 GAAGTCTTCTTCTATGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007745780 Original CRISPR CTTGAAGTTCAGAGGGAACC TGG (reversed) Intergenic
No off target data available for this crispr