ID: 1007746489

View in Genome Browser
Species Human (GRCh38)
Location 6:44046496-44046518
Sequence TCCCATCTGCTCTCCTCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007746480_1007746489 20 Left 1007746480 6:44046453-44046475 CCACGCCCAGCCCATGACATTCA No data
Right 1007746489 6:44046496-44046518 TCCCATCTGCTCTCCTCCACAGG No data
1007746479_1007746489 23 Left 1007746479 6:44046450-44046472 CCACCACGCCCAGCCCATGACAT No data
Right 1007746489 6:44046496-44046518 TCCCATCTGCTCTCCTCCACAGG No data
1007746482_1007746489 14 Left 1007746482 6:44046459-44046481 CCAGCCCATGACATTCATTTCTA No data
Right 1007746489 6:44046496-44046518 TCCCATCTGCTCTCCTCCACAGG No data
1007746481_1007746489 15 Left 1007746481 6:44046458-44046480 CCCAGCCCATGACATTCATTTCT No data
Right 1007746489 6:44046496-44046518 TCCCATCTGCTCTCCTCCACAGG No data
1007746486_1007746489 -9 Left 1007746486 6:44046482-44046504 CCACATCCCAGGTATCCCATCTG No data
Right 1007746489 6:44046496-44046518 TCCCATCTGCTCTCCTCCACAGG No data
1007746484_1007746489 9 Left 1007746484 6:44046464-44046486 CCATGACATTCATTTCTACCACA No data
Right 1007746489 6:44046496-44046518 TCCCATCTGCTCTCCTCCACAGG No data
1007746483_1007746489 10 Left 1007746483 6:44046463-44046485 CCCATGACATTCATTTCTACCAC No data
Right 1007746489 6:44046496-44046518 TCCCATCTGCTCTCCTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007746489 Original CRISPR TCCCATCTGCTCTCCTCCAC AGG Intergenic
No off target data available for this crispr