ID: 1007748653

View in Genome Browser
Species Human (GRCh38)
Location 6:44058622-44058644
Sequence CTGGCTGTCGACAGTGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007748653_1007748658 11 Left 1007748653 6:44058622-44058644 CCTGCCCCACTGTCGACAGCCAG No data
Right 1007748658 6:44058656-44058678 AACTCCTGAGCCTTTCCTCTTGG No data
1007748653_1007748661 24 Left 1007748653 6:44058622-44058644 CCTGCCCCACTGTCGACAGCCAG No data
Right 1007748661 6:44058669-44058691 TTCCTCTTGGCCAGAGATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007748653 Original CRISPR CTGGCTGTCGACAGTGGGGC AGG (reversed) Intergenic
No off target data available for this crispr