ID: 1007749106

View in Genome Browser
Species Human (GRCh38)
Location 6:44061141-44061163
Sequence CACATTTGGTCACAAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007749091_1007749106 16 Left 1007749091 6:44061102-44061124 CCCTGACCCCCAAGCTCTCCTCC No data
Right 1007749106 6:44061141-44061163 CACATTTGGTCACAAGAAGCTGG No data
1007749097_1007749106 7 Left 1007749097 6:44061111-44061133 CCAAGCTCTCCTCCTTGGCCAGG No data
Right 1007749106 6:44061141-44061163 CACATTTGGTCACAAGAAGCTGG No data
1007749096_1007749106 8 Left 1007749096 6:44061110-44061132 CCCAAGCTCTCCTCCTTGGCCAG No data
Right 1007749106 6:44061141-44061163 CACATTTGGTCACAAGAAGCTGG No data
1007749100_1007749106 -2 Left 1007749100 6:44061120-44061142 CCTCCTTGGCCAGGCCAGGTCCA No data
Right 1007749106 6:44061141-44061163 CACATTTGGTCACAAGAAGCTGG No data
1007749095_1007749106 9 Left 1007749095 6:44061109-44061131 CCCCAAGCTCTCCTCCTTGGCCA No data
Right 1007749106 6:44061141-44061163 CACATTTGGTCACAAGAAGCTGG No data
1007749101_1007749106 -5 Left 1007749101 6:44061123-44061145 CCTTGGCCAGGCCAGGTCCACAT No data
Right 1007749106 6:44061141-44061163 CACATTTGGTCACAAGAAGCTGG No data
1007749094_1007749106 10 Left 1007749094 6:44061108-44061130 CCCCCAAGCTCTCCTCCTTGGCC No data
Right 1007749106 6:44061141-44061163 CACATTTGGTCACAAGAAGCTGG No data
1007749092_1007749106 15 Left 1007749092 6:44061103-44061125 CCTGACCCCCAAGCTCTCCTCCT No data
Right 1007749106 6:44061141-44061163 CACATTTGGTCACAAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007749106 Original CRISPR CACATTTGGTCACAAGAAGC TGG Intergenic
No off target data available for this crispr