ID: 1007749768

View in Genome Browser
Species Human (GRCh38)
Location 6:44064730-44064752
Sequence GACAATGAAGTGACCACAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007749763_1007749768 -9 Left 1007749763 6:44064716-44064738 CCTTCCCAGCCACTGACAATGAA No data
Right 1007749768 6:44064730-44064752 GACAATGAAGTGACCACAGGCGG No data
1007749762_1007749768 29 Left 1007749762 6:44064678-44064700 CCATGGGGGCTGAGTCACTGGCT No data
Right 1007749768 6:44064730-44064752 GACAATGAAGTGACCACAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007749768 Original CRISPR GACAATGAAGTGACCACAGG CGG Intergenic
No off target data available for this crispr