ID: 1007751105

View in Genome Browser
Species Human (GRCh38)
Location 6:44072621-44072643
Sequence CTGGGCCACTGGCAAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007751105_1007751117 18 Left 1007751105 6:44072621-44072643 CCACCCACTTGCCAGTGGCCCAG No data
Right 1007751117 6:44072662-44072684 GCCAATCCCCTTCCTGATCAGGG No data
1007751105_1007751116 17 Left 1007751105 6:44072621-44072643 CCACCCACTTGCCAGTGGCCCAG No data
Right 1007751116 6:44072661-44072683 TGCCAATCCCCTTCCTGATCAGG No data
1007751105_1007751121 25 Left 1007751105 6:44072621-44072643 CCACCCACTTGCCAGTGGCCCAG No data
Right 1007751121 6:44072669-44072691 CCCTTCCTGATCAGGGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007751105 Original CRISPR CTGGGCCACTGGCAAGTGGG TGG (reversed) Intergenic
No off target data available for this crispr