ID: 1007752021

View in Genome Browser
Species Human (GRCh38)
Location 6:44076597-44076619
Sequence CAGAGTCCCCGCCACGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007752021_1007752030 19 Left 1007752021 6:44076597-44076619 CCGGCGGCGTGGCGGGGACTCTG No data
Right 1007752030 6:44076639-44076661 GTCCGGAGCAGCTGACCCGCTGG No data
1007752021_1007752032 22 Left 1007752021 6:44076597-44076619 CCGGCGGCGTGGCGGGGACTCTG No data
Right 1007752032 6:44076642-44076664 CGGAGCAGCTGACCCGCTGGCGG No data
1007752021_1007752033 25 Left 1007752021 6:44076597-44076619 CCGGCGGCGTGGCGGGGACTCTG No data
Right 1007752033 6:44076645-44076667 AGCAGCTGACCCGCTGGCGGTGG No data
1007752021_1007752025 2 Left 1007752021 6:44076597-44076619 CCGGCGGCGTGGCGGGGACTCTG No data
Right 1007752025 6:44076622-44076644 CGGCAGCCTCCCGCGCCGTCCGG No data
1007752021_1007752034 26 Left 1007752021 6:44076597-44076619 CCGGCGGCGTGGCGGGGACTCTG No data
Right 1007752034 6:44076646-44076668 GCAGCTGACCCGCTGGCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007752021 Original CRISPR CAGAGTCCCCGCCACGCCGC CGG (reversed) Intergenic
No off target data available for this crispr