ID: 1007752542

View in Genome Browser
Species Human (GRCh38)
Location 6:44079258-44079280
Sequence CTGTAAGGGAGAAAAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007752542_1007752551 25 Left 1007752542 6:44079258-44079280 CCTCCTCCTTTTCTCCCTTACAG No data
Right 1007752551 6:44079306-44079328 TTCACTTCAAGCATGAGCTGAGG No data
1007752542_1007752552 26 Left 1007752542 6:44079258-44079280 CCTCCTCCTTTTCTCCCTTACAG No data
Right 1007752552 6:44079307-44079329 TCACTTCAAGCATGAGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007752542 Original CRISPR CTGTAAGGGAGAAAAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr