ID: 1007754240

View in Genome Browser
Species Human (GRCh38)
Location 6:44088544-44088566
Sequence ATTTAAATGAAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007754240_1007754243 5 Left 1007754240 6:44088544-44088566 CCAGCCTCCTTCTTCATTTAAAT No data
Right 1007754243 6:44088572-44088594 ATAAAAAGTTAACCAAGATCTGG No data
1007754240_1007754244 6 Left 1007754240 6:44088544-44088566 CCAGCCTCCTTCTTCATTTAAAT No data
Right 1007754244 6:44088573-44088595 TAAAAAGTTAACCAAGATCTGGG No data
1007754240_1007754246 19 Left 1007754240 6:44088544-44088566 CCAGCCTCCTTCTTCATTTAAAT No data
Right 1007754246 6:44088586-44088608 AAGATCTGGGCCAAGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007754240 Original CRISPR ATTTAAATGAAGAAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr