ID: 1007754502

View in Genome Browser
Species Human (GRCh38)
Location 6:44090242-44090264
Sequence GAAATCTATCCCCTCCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007754502_1007754508 10 Left 1007754502 6:44090242-44090264 CCACCATGGAGGGGATAGATTTC No data
Right 1007754508 6:44090275-44090297 CCATCATGCTCCAGTAGCAGAGG No data
1007754502_1007754509 11 Left 1007754502 6:44090242-44090264 CCACCATGGAGGGGATAGATTTC No data
Right 1007754509 6:44090276-44090298 CATCATGCTCCAGTAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007754502 Original CRISPR GAAATCTATCCCCTCCATGG TGG (reversed) Intergenic
No off target data available for this crispr