ID: 1007756254

View in Genome Browser
Species Human (GRCh38)
Location 6:44101626-44101648
Sequence GACCCCTGGGGGGACCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007756254_1007756267 28 Left 1007756254 6:44101626-44101648 CCCCAGGGGTCCCCCCAGGGGTC No data
Right 1007756267 6:44101677-44101699 GCAGCCTGATCCCAATTCCCTGG No data
1007756254_1007756262 -6 Left 1007756254 6:44101626-44101648 CCCCAGGGGTCCCCCCAGGGGTC No data
Right 1007756262 6:44101643-44101665 GGGGTCTCCATGCAGAGCCTAGG No data
1007756254_1007756264 6 Left 1007756254 6:44101626-44101648 CCCCAGGGGTCCCCCCAGGGGTC No data
Right 1007756264 6:44101655-44101677 CAGAGCCTAGGCTCTCCATCAGG No data
1007756254_1007756268 29 Left 1007756254 6:44101626-44101648 CCCCAGGGGTCCCCCCAGGGGTC No data
Right 1007756268 6:44101678-44101700 CAGCCTGATCCCAATTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007756254 Original CRISPR GACCCCTGGGGGGACCCCTG GGG (reversed) Intergenic
No off target data available for this crispr