ID: 1007756842

View in Genome Browser
Species Human (GRCh38)
Location 6:44104998-44105020
Sequence CAGAAAAAGCAGAAGAAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007756841_1007756842 -7 Left 1007756841 6:44104982-44105004 CCACAGGTCAGTGCAGCAGAAAA No data
Right 1007756842 6:44104998-44105020 CAGAAAAAGCAGAAGAAATGTGG No data
1007756838_1007756842 9 Left 1007756838 6:44104966-44104988 CCAAGAAATATTTCCACCACAGG No data
Right 1007756842 6:44104998-44105020 CAGAAAAAGCAGAAGAAATGTGG No data
1007756840_1007756842 -4 Left 1007756840 6:44104979-44105001 CCACCACAGGTCAGTGCAGCAGA No data
Right 1007756842 6:44104998-44105020 CAGAAAAAGCAGAAGAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007756842 Original CRISPR CAGAAAAAGCAGAAGAAATG TGG Intergenic
No off target data available for this crispr