ID: 1007757314

View in Genome Browser
Species Human (GRCh38)
Location 6:44108393-44108415
Sequence AGGCAGGTACACATGGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007757314_1007757326 19 Left 1007757314 6:44108393-44108415 CCCTGACCCATGTGTACCTGCCT No data
Right 1007757326 6:44108435-44108457 GGCCAGCCAGGAAGGGCGCTGGG No data
1007757314_1007757323 12 Left 1007757314 6:44108393-44108415 CCCTGACCCATGTGTACCTGCCT No data
Right 1007757323 6:44108428-44108450 CAGCCATGGCCAGCCAGGAAGGG No data
1007757314_1007757322 11 Left 1007757314 6:44108393-44108415 CCCTGACCCATGTGTACCTGCCT No data
Right 1007757322 6:44108427-44108449 TCAGCCATGGCCAGCCAGGAAGG No data
1007757314_1007757329 30 Left 1007757314 6:44108393-44108415 CCCTGACCCATGTGTACCTGCCT No data
Right 1007757329 6:44108446-44108468 AAGGGCGCTGGGTTAGCCTGTGG No data
1007757314_1007757325 18 Left 1007757314 6:44108393-44108415 CCCTGACCCATGTGTACCTGCCT No data
Right 1007757325 6:44108434-44108456 TGGCCAGCCAGGAAGGGCGCTGG No data
1007757314_1007757321 7 Left 1007757314 6:44108393-44108415 CCCTGACCCATGTGTACCTGCCT No data
Right 1007757321 6:44108423-44108445 GACATCAGCCATGGCCAGCCAGG No data
1007757314_1007757320 -2 Left 1007757314 6:44108393-44108415 CCCTGACCCATGTGTACCTGCCT No data
Right 1007757320 6:44108414-44108436 CTCTTTGCAGACATCAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007757314 Original CRISPR AGGCAGGTACACATGGGTCA GGG (reversed) Intergenic
No off target data available for this crispr