ID: 1007759971

View in Genome Browser
Species Human (GRCh38)
Location 6:44127851-44127873
Sequence GACTCACATTTGGCTCGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007759971_1007759983 15 Left 1007759971 6:44127851-44127873 CCATCCCGAGCCAAATGTGAGTC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1007759983 6:44127889-44127911 GAGGTCCAGATACGCGCCGCCGG 0: 1
1: 0
2: 0
3: 0
4: 14
1007759971_1007759975 -7 Left 1007759971 6:44127851-44127873 CCATCCCGAGCCAAATGTGAGTC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1007759975 6:44127867-44127889 GTGAGTCCTCCAACCCCTGCCGG 0: 1
1: 0
2: 0
3: 13
4: 153
1007759971_1007759976 -4 Left 1007759971 6:44127851-44127873 CCATCCCGAGCCAAATGTGAGTC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1007759976 6:44127870-44127892 AGTCCTCCAACCCCTGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007759971 Original CRISPR GACTCACATTTGGCTCGGGA TGG (reversed) Intronic
903994294 1:27296056-27296078 GAATCACATTTGGCTGGGCATGG - Intronic
907837237 1:58121649-58121671 GGCTCACAGTTGGGTCGGGCAGG - Intronic
915019953 1:152769730-152769752 GATTCACTGTTGGCTTGGGATGG - Intronic
919547704 1:198944263-198944285 GACTCATATTTAGATGGGGAAGG - Intergenic
920038713 1:203082522-203082544 GATTCAGATTTAGCTCGGGGAGG - Intergenic
922061994 1:222101606-222101628 CACTCACACCTGGCTCGGGTGGG - Intergenic
1065492148 10:26292861-26292883 GATTCACATTTGGCCCAGGCTGG - Intronic
1069871637 10:71536612-71536634 GACTCACTTTTGGGTGGGGCAGG + Intronic
1074161394 10:110839499-110839521 CCCTGACATTTGGCTGGGGAAGG + Intergenic
1075102286 10:119514967-119514989 GATTCACATTTGGCTATTGAAGG - Intronic
1075207349 10:120458407-120458429 GCCTCCTGTTTGGCTCGGGAGGG - Intronic
1076351749 10:129820250-129820272 GACTTACAGATGGCTGGGGAGGG + Intergenic
1076478316 10:130767701-130767723 GAGCCACATTTGGCTCTGCATGG - Intergenic
1076701226 10:132274311-132274333 GACCCACATTTGGTGTGGGATGG - Intronic
1079366085 11:19811370-19811392 GACTCCCATTTGGTTTGGGAAGG + Intronic
1086168287 11:83806021-83806043 GAATAACATTAGGCTAGGGATGG - Intronic
1096407170 12:51352314-51352336 GACTCTGATAAGGCTCGGGAGGG - Exonic
1097510337 12:60530570-60530592 GACTCAGATTTTACTCGTGATGG - Intergenic
1098213670 12:68193301-68193323 GAATCTCATTTGACTAGGGATGG + Intergenic
1100930285 12:99600670-99600692 GACACACAGTTAGCTCAGGAGGG + Intronic
1101632149 12:106505565-106505587 AACTCACTTTTGGCTGGGCATGG - Intronic
1113190728 13:107742594-107742616 GACTCACATTTCTGTAGGGATGG - Intronic
1113975003 13:114220956-114220978 GACTCACACTTGGCTGGGCATGG + Intergenic
1116337352 14:43673997-43674019 GACTTACACATGGCTGGGGAAGG - Intergenic
1117184368 14:53225598-53225620 GACTCAAATTTGGCTCAGATAGG + Intergenic
1117999116 14:61506469-61506491 GGTTCACATTTGGTTCAGGAGGG - Intronic
1119067600 14:71545808-71545830 GTCTCATATTTGGCTGGGTATGG + Intronic
1129318591 15:74761400-74761422 GACTGAGATTTGGCTGGGCATGG - Intergenic
1136630655 16:31487719-31487741 GACTCACAATCGTCTCGGGCTGG + Exonic
1138185109 16:54970895-54970917 GACTCAGATATGGCTCGCCAAGG - Intergenic
1140024932 16:71278675-71278697 TACTCAAATTTGGCTTGGGTGGG - Intergenic
1141266585 16:82503198-82503220 CACTCACAATGGGCTGGGGATGG - Intergenic
1141379956 16:83567243-83567265 GACTCACAGATTGCTAGGGAAGG - Intronic
1144322101 17:14136483-14136505 GACTGACATTTGGCTTGTGTGGG + Intronic
1153028074 18:689171-689193 GAGTCACCTTGGGCTCTGGAAGG - Intronic
1153030877 18:712110-712132 GACTCACATTTTGCTGGAAATGG - Intronic
1160895531 19:1400341-1400363 GAGTCACATTTGCCACAGGACGG + Intronic
1161293235 19:3506723-3506745 GACTTACAGGTGGCTCGGGGTGG - Intronic
1161407252 19:4097599-4097621 GTCACACATTTGGCTCGGTGAGG + Intronic
1161434735 19:4256335-4256357 AACTCACATTTGGCAGGGGTGGG - Intronic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
928125320 2:28611565-28611587 AACTCACAATTGGCTCAGGTGGG - Intronic
930710744 2:54549008-54549030 GACTTGCATTTGGCTGGGCACGG + Intronic
930851590 2:55966729-55966751 CACTGACACTTGGCTCTGGATGG - Intergenic
931166651 2:59756168-59756190 GACTCAGCTTTGGCTAGGGTGGG - Intergenic
931959382 2:67465319-67465341 GACTCACATGTGGCACTTGAGGG + Intergenic
933778728 2:85787288-85787310 GACTCATCTTTGGCTTGAGATGG - Exonic
942482501 2:176404338-176404360 GACTGGCATTGGGCTGGGGAGGG - Intergenic
945355831 2:208838454-208838476 GACTCACCCTGGGCTTGGGAAGG - Intronic
1174147655 20:48463388-48463410 GTCACACATTTGGGTGGGGAGGG - Intergenic
1175989377 20:62780078-62780100 TACCCACATTTGGCTGGGCATGG - Intergenic
1179036192 21:37760509-37760531 GACTTACATCTGTCTGGGGAGGG - Intronic
1182412102 22:30195953-30195975 GTTTCACATTTGTCTTGGGATGG + Intergenic
1182451441 22:30424151-30424173 GACTCACACTTGGCTCGCACGGG - Exonic
953309644 3:41864136-41864158 GACTCCCCTTTGGCTAGGGCTGG + Intronic
956082808 3:65577762-65577784 GACTCACACTTGGCTCATCAAGG + Intronic
969099381 4:4757381-4757403 GACCCACATGTGGCTCTAGAAGG + Intergenic
977780075 4:100970652-100970674 GACTCACATTTTCCTGCGGAAGG - Intergenic
978008762 4:103652281-103652303 GACTCCCATCTGGCTAGGGCTGG + Intronic
982014816 4:151142945-151142967 GACTAACTTTTGGCTGGGCATGG + Intronic
989813526 5:45707897-45707919 GACTCACATTTGTCAGGGGAAGG - Intergenic
993376863 5:87158621-87158643 GATACACATTTGGCTGGGCATGG - Intergenic
996477408 5:123937190-123937212 GACTAAAATTTGGCTTTGGAGGG + Intergenic
997667416 5:135642829-135642851 GACTCAAATGTGGCTCCTGATGG + Intergenic
999955545 5:156697552-156697574 AACTCACATTTGGCTGCTGAAGG - Intronic
1000093475 5:157950492-157950514 CACTCAAATTTGGCTGGGCACGG + Intergenic
1001569299 5:172719656-172719678 GGCTCACAGTTGGCTTGGGTGGG + Intergenic
1005119130 6:22371001-22371023 GACTCAAACTTGGCTTTGGAAGG - Intergenic
1007759971 6:44127851-44127873 GACTCACATTTGGCTCGGGATGG - Intronic
1008088240 6:47266863-47266885 GAGGCAACTTTGGCTCGGGAGGG - Intronic
1012383172 6:98644776-98644798 TACTCATATGTGGCTCAGGATGG - Intergenic
1019954631 7:4403650-4403672 CGCTGACATTTGGGTCGGGAAGG - Intergenic
1024682994 7:51713568-51713590 GACTCCTATTTGGCTTGGCATGG - Intergenic
1026688997 7:72536242-72536264 GACTCACATCTGGGTTGGGGAGG + Intergenic
1030680069 7:112425157-112425179 AACTGACATTTGGCTAGGCATGG - Intronic
1033741313 7:144277600-144277622 GTCTCACATCAGGCTCTGGAAGG + Intergenic
1033752590 7:144372014-144372036 GTCTCACATCAGGCTCTGGAAGG - Exonic
1035458831 7:159026821-159026843 CACGCACATTTGGCTCTCGAAGG - Intergenic
1037238905 8:16754732-16754754 CATTCACATTCGGCACGGGATGG + Intergenic
1047087664 8:121536845-121536867 GACTCACACTTTGATAGGGAGGG + Intergenic
1048545163 8:135379819-135379841 GCCTCCCATTTGGCTGGGGCAGG + Intergenic
1049283441 8:141762179-141762201 GCCTGCCATTTGGCTCCGGAAGG - Intergenic
1050248075 9:3713120-3713142 GACCCACATCTGGCTAGGGCTGG - Intergenic
1056052434 9:82783300-82783322 GGCTCAAATTTGGCCTGGGAAGG + Intergenic
1062716594 9:138013523-138013545 GATTCACAGTTGCCTGGGGAGGG - Intronic
1195349682 X:103984720-103984742 CACTAACATGTGGCTCAGGAGGG - Intergenic
1195356998 X:104048477-104048499 CACTAACATGTGGCTCAGGACGG - Intergenic
1195357761 X:104054119-104054141 CACTAACATGTGGCTCAGGAGGG + Intergenic