ID: 1007760022

View in Genome Browser
Species Human (GRCh38)
Location 6:44127990-44128012
Sequence CAGGGGACGCGCACCTGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007760022_1007760038 29 Left 1007760022 6:44127990-44128012 CCGGTGCAGGTGCGCGTCCCCTG 0: 1
1: 0
2: 1
3: 8
4: 119
Right 1007760038 6:44128042-44128064 CGCCTGTCCGCCGCCGTTTGGGG No data
1007760022_1007760025 -9 Left 1007760022 6:44127990-44128012 CCGGTGCAGGTGCGCGTCCCCTG 0: 1
1: 0
2: 1
3: 8
4: 119
Right 1007760025 6:44128004-44128026 CGTCCCCTGCGCGACCCTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 76
1007760022_1007760026 -8 Left 1007760022 6:44127990-44128012 CCGGTGCAGGTGCGCGTCCCCTG 0: 1
1: 0
2: 1
3: 8
4: 119
Right 1007760026 6:44128005-44128027 GTCCCCTGCGCGACCCTCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 69
1007760022_1007760035 27 Left 1007760022 6:44127990-44128012 CCGGTGCAGGTGCGCGTCCCCTG 0: 1
1: 0
2: 1
3: 8
4: 119
Right 1007760035 6:44128040-44128062 CCCGCCTGTCCGCCGCCGTTTGG 0: 1
1: 0
2: 0
3: 1
4: 36
1007760022_1007760037 28 Left 1007760022 6:44127990-44128012 CCGGTGCAGGTGCGCGTCCCCTG 0: 1
1: 0
2: 1
3: 8
4: 119
Right 1007760037 6:44128041-44128063 CCGCCTGTCCGCCGCCGTTTGGG 0: 1
1: 0
2: 0
3: 4
4: 31
1007760022_1007760024 -10 Left 1007760022 6:44127990-44128012 CCGGTGCAGGTGCGCGTCCCCTG 0: 1
1: 0
2: 1
3: 8
4: 119
Right 1007760024 6:44128003-44128025 GCGTCCCCTGCGCGACCCTCGGG 0: 1
1: 0
2: 1
3: 8
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007760022 Original CRISPR CAGGGGACGCGCACCTGCAC CGG (reversed) Intronic