ID: 1007761032

View in Genome Browser
Species Human (GRCh38)
Location 6:44133871-44133893
Sequence CTGTGCAAATAACTGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007761032 Original CRISPR CTGTGCAAATAACTGGAGAG AGG Intronic
901467981 1:9435293-9435315 CTGTGCAAATAACACCAGACTGG - Intergenic
906167390 1:43697091-43697113 GTGTGCAAGTAACTGGGGAATGG + Intronic
909658062 1:78052927-78052949 CAGTGCAAATAACTGGCAAGTGG + Intronic
909908580 1:81231137-81231159 CTGTGTAATTAACTGTAGAGTGG + Intergenic
910345924 1:86238275-86238297 CTGTGCAAATAAGAGGAGGGAGG - Intergenic
911316566 1:96363078-96363100 CTTTGCAAATAACAGTAGACAGG + Intergenic
911946237 1:104113171-104113193 CTGAGCAAATAAAAAGAGAGTGG + Intergenic
915359923 1:155279671-155279693 ATGGGCAGATAACTGGAGATGGG + Intronic
916135205 1:161646655-161646677 CTGTGGACATAGCAGGAGAGTGG + Intronic
920258813 1:204674889-204674911 CTGTGCTAAGAACTGGGCAGAGG - Intronic
924376854 1:243419639-243419661 CTGTTTAAATAACTGGTGAGTGG + Intronic
1063596832 10:7442888-7442910 CTCTGCAGAGAACTGCAGAGTGG - Intergenic
1063600831 10:7479927-7479949 CTGTGGATAAAACTGCAGAGAGG + Intergenic
1063828296 10:9923791-9923813 CTGTGCAAGAGACTGCAGAGAGG + Intergenic
1065533216 10:26694196-26694218 CATTTCAAATCACTGGAGAGAGG + Intergenic
1066349957 10:34628039-34628061 CTGTGCAAATCCCAGGAGAGTGG - Intronic
1067027674 10:42858532-42858554 CTTTCCAAATGCCTGGAGAGTGG - Intergenic
1067277240 10:44846599-44846621 CTGTGCTTATCACTGTAGAGTGG - Intergenic
1067671912 10:48331546-48331568 CTGTGCAAACAGCTGAACAGGGG - Intronic
1068637819 10:59367444-59367466 CTGTTATAATAACAGGAGAGAGG - Intergenic
1070378582 10:75858390-75858412 CTGTGATAATTAGTGGAGAGGGG - Intronic
1070765923 10:79056357-79056379 CTGTGTAACTATCTGGTGAGTGG - Intergenic
1074120843 10:110493583-110493605 CTCTGAAAATAACTGTTGAGGGG + Intergenic
1077418108 11:2435310-2435332 CTGTGCAAATAACTGGACGAAGG + Intergenic
1077500161 11:2905920-2905942 CTGTGCAGAGAAACGGAGAGAGG + Intronic
1080504359 11:32897858-32897880 CTGGGCAACTAAGTGGACAGAGG - Intronic
1082224008 11:49679269-49679291 ATGTGCAAATAACTGTACATAGG - Intergenic
1083682979 11:64359712-64359734 CTATGCAAATCACTTGAGAGGGG - Intronic
1084032496 11:66489164-66489186 TTGTGCAAAGACCTGGACAGGGG - Intronic
1086625032 11:88939900-88939922 ATGTGCAAATAACTGTACATAGG + Intronic
1087125972 11:94626069-94626091 CTGTGCAAGCAACAGGAGGGGGG - Intergenic
1090118313 11:123998435-123998457 CTTTACAAATACCTGGAGAGGGG - Intergenic
1091522634 12:1263092-1263114 GTGTACAGATAACTGCAGAGCGG + Exonic
1093690638 12:22104547-22104569 CTGTGCTGATGACTGGAGGGTGG + Intronic
1095710244 12:45280441-45280463 CTGTGCTAGTAATTGGTGAGGGG - Intronic
1097105519 12:56621094-56621116 GTGTACAAAAAACTGGGGAGAGG - Intronic
1098881609 12:75922997-75923019 CTTTGGAATTAAATGGAGAGAGG - Intergenic
1099190553 12:79557480-79557502 AGCTGCAAATAACTGAAGAGGGG + Intergenic
1102781393 12:115568285-115568307 ATCTGCAATTTACTGGAGAGAGG + Intergenic
1102822245 12:115917646-115917668 CTGTGCAAAGGCCTGGAGATAGG + Intergenic
1106358324 13:29006087-29006109 CTGTGCAAGTTCCTGGAGAGGGG + Intronic
1106396293 13:29384134-29384156 CTGTGAATATATCTGGAGAAAGG + Intronic
1106595774 13:31134568-31134590 CTATACAAATATTTGGAGAGAGG - Intergenic
1106674669 13:31945756-31945778 CTGTGCTATTAACTGTAGAAAGG + Intergenic
1108443607 13:50482684-50482706 ATATGCAAATTACTGGAGAAAGG + Intronic
1113248110 13:108421076-108421098 ATCTGCAAGTAACTGAAGAGTGG - Intergenic
1118138911 14:63058174-63058196 ATCTGCAATTTACTGGAGAGAGG - Intronic
1118525907 14:66642381-66642403 CTATGTAAAAGACTGGAGAGAGG + Intronic
1118827823 14:69399733-69399755 CTGTGCATTTACCTGGAGAGAGG + Intronic
1119312804 14:73664043-73664065 CTGTGTACATAACTGAAAAGGGG + Intronic
1119921438 14:78450137-78450159 CTGTGCAAATGACTGGGTATAGG + Intronic
1120188366 14:81417588-81417610 CTGTGCAATTAATTGGAGACAGG + Intronic
1120524426 14:85561252-85561274 CTGTACATGTATCTGGAGAGAGG + Intronic
1121276459 14:92671338-92671360 GTGTGCAAAGGCCTGGAGAGGGG + Intronic
1121392956 14:93591839-93591861 ATTTGCAATTTACTGGAGAGAGG + Intronic
1124959491 15:34383785-34383807 CTGAACAAATAAAAGGAGAGAGG - Exonic
1124976117 15:34530006-34530028 CTGAACAAATAAAAGGAGAGAGG - Exonic
1125145955 15:36468617-36468639 CTGTGCATAAAACTTGAAAGGGG + Intergenic
1125322998 15:38508653-38508675 CTGAGCAAAGGACAGGAGAGAGG + Intronic
1125410671 15:39402718-39402740 CTGTGCAAAGAACTAGAAATGGG + Intergenic
1128400802 15:67278526-67278548 CTGTCCTGAAAACTGGAGAGAGG - Intronic
1130285368 15:82550163-82550185 CAGTGGAAATGACTGGCGAGAGG + Intronic
1130485874 15:84398271-84398293 CTTTCCAAATGGCTGGAGAGTGG - Intergenic
1131082174 15:89546103-89546125 CTGTGCATTTAACCCGAGAGTGG - Intergenic
1132973345 16:2699707-2699729 CTGTGCTGAGAACTGCAGAGTGG + Intronic
1134486399 16:14662099-14662121 CTCTGCAAATAACTTGACAGTGG - Intronic
1136454553 16:30372867-30372889 CTGAGCAAAGGCCTGGAGAGCGG - Intronic
1137752353 16:50875911-50875933 CTGTTCACATAGCTGGAAAGTGG - Intergenic
1138527247 16:57616163-57616185 CTGTGCAAATATCGGGTTAGCGG + Intronic
1140192589 16:72830592-72830614 CTGTGTACTGAACTGGAGAGAGG - Intronic
1141630737 16:85286564-85286586 CTGTGAAAATAAATTAAGAGTGG + Intergenic
1143806494 17:9432460-9432482 GTTTGGAAATAAATGGAGAGTGG - Intronic
1143988025 17:10931971-10931993 GTGTCCACAGAACTGGAGAGTGG - Intergenic
1144612482 17:16734294-16734316 CTTTGCATATATCTGGACAGAGG - Intronic
1144900247 17:18580992-18581014 CTTTGCATATATCTGGACAGAGG + Intergenic
1145132198 17:20364682-20364704 CTTTGCATATATCTGGACAGAGG - Intergenic
1145398088 17:22511844-22511866 AGGTACAAAGAACTGGAGAGAGG - Intergenic
1151069782 17:71195644-71195666 CTGTGAAAATAAATGATGAGCGG + Intergenic
1151600846 17:75105170-75105192 CTGTGCAGAGAACGGGAGGGGGG + Intronic
1152302086 17:79500982-79501004 CTGTGGAAATCACTGCCGAGGGG + Intronic
1157787249 18:50494991-50495013 CTGGGAAAATATCTGGAAAGAGG - Intergenic
1158216974 18:55110638-55110660 CTCTCCAAATAGATGGAGAGAGG - Intergenic
1159688674 18:71457912-71457934 CTGTGAGAATAAATGGAGTGGGG - Intergenic
1160735589 19:660958-660980 AAGAGCAAATAACTGCAGAGAGG - Intronic
1161762510 19:6184726-6184748 CTGTCCTAATCACTGCAGAGAGG + Intronic
1165279695 19:34785599-34785621 CAGTGCCAAGAACTTGAGAGTGG + Intergenic
1165350068 19:35270336-35270358 CTCTGCAATTAACAGGAGTGGGG - Intronic
1166990611 19:46690430-46690452 CTGTACAAAGACCTGGTGAGAGG - Intronic
926451150 2:13005847-13005869 CAGTGCAAAGAACTGGAGACAGG - Intergenic
927978033 2:27355135-27355157 CAGTGCAAATAAATAGAGTGGGG - Intronic
930436830 2:51355060-51355082 CCTTGCAGATAACTGGAAAGAGG - Intergenic
930515128 2:52397283-52397305 GTTTTCAGATAACTGGAGAGGGG + Intergenic
931386489 2:61802348-61802370 CTGCCCAAATCACTGGAGGGAGG - Intergenic
932004102 2:67910905-67910927 CTGTCCAAATTACAGCAGAGAGG + Intergenic
933551915 2:83788758-83788780 TTGTGCAAATAACTGAACTGAGG - Intergenic
939152393 2:138488334-138488356 CTGAATAAATAACTGGAGAATGG + Intergenic
940268155 2:151861878-151861900 CATTGCAAATAAATGCAGAGGGG + Intronic
941810233 2:169748294-169748316 CTGTGCAGAGACCTGGGGAGAGG + Intronic
942940711 2:181612413-181612435 CTGAGGGAATAACTAGAGAGTGG - Intronic
946136244 2:217649630-217649652 CATTTCAAATAACTGGAGAAGGG + Intronic
947128421 2:226896309-226896331 TTGTGCAACTAAATGGATAGTGG - Intronic
947709693 2:232305538-232305560 CTCTTCAAATAACTGGAAAGAGG - Intronic
1170312974 20:15012738-15012760 CTGTGCAGACAACCGGAGACCGG - Intronic
1175222485 20:57425434-57425456 CTGTGCAAATGCCTGGAGGTTGG + Intergenic
1177188940 21:17827963-17827985 CTGTGCACATTACTGAAGACTGG - Intergenic
1180993303 22:19951723-19951745 TTGTGCAAAGAAGTGGGGAGTGG + Intronic
1181075512 22:20373461-20373483 CTCTGCAAAATGCTGGAGAGAGG - Intronic
1184209205 22:43025351-43025373 CTGTGCAAATGAGTGGAGGGTGG - Intergenic
949261994 3:2113758-2113780 CTTTGAAAATCACTGGAGGGAGG + Intronic
951683036 3:25314428-25314450 CTGTGAAAATAGCTTGATAGAGG - Intronic
952040193 3:29252194-29252216 CTGCACCAAAAACTGGAGAGAGG + Intergenic
952455820 3:33470949-33470971 GTTTGCAAGTAAATGGAGAGAGG - Intergenic
956905642 3:73762469-73762491 GTCTGCAAAGAACTGGAGAATGG - Intergenic
957621333 3:82596445-82596467 CTGTTCAAATAACAGGAGAAGGG + Intergenic
957787139 3:84897645-84897667 CTGTGAAAATAACTGCAGTTTGG + Intergenic
960639134 3:119810158-119810180 CTGCGCAAGTGCCTGGAGAGCGG + Exonic
960805988 3:121584339-121584361 CTGAACAAATAAATGAAGAGAGG + Intronic
962624009 3:137207390-137207412 CTTTGCGAATCACTTGAGAGAGG + Intergenic
967742378 3:193017636-193017658 CTGTGGAAATAGCCAGAGAGAGG + Intergenic
968670345 4:1846883-1846905 CTGAACAAATAACAGGAAAGGGG + Intronic
969666541 4:8560612-8560634 CTGTGCATGGAGCTGGAGAGAGG + Intronic
971454853 4:26834599-26834621 ATGTGCAAAGAAGTGGAGATGGG + Intergenic
975559153 4:75693399-75693421 AGCTGCAAAAAACTGGAGAGAGG - Intronic
977862178 4:101975513-101975535 CTGGACAAATAACTAGAAAGAGG - Intronic
980725973 4:136761431-136761453 CTGAGCAAGAAACTGGAAAGGGG - Intergenic
981599101 4:146465163-146465185 ATGTGCACATTTCTGGAGAGAGG - Intronic
981755174 4:148135049-148135071 TTGTACAAAGAACTGGAGGGTGG + Intronic
982761812 4:159293780-159293802 CTGAGCCAAAAAATGGAGAGGGG - Intronic
982786686 4:159544424-159544446 CTGTGTAAATGACAGGAGACAGG - Intergenic
984003995 4:174286208-174286230 CTGTGGAAATGAGTGGCGAGGGG + Intronic
984392285 4:179151484-179151506 CTGTGCAGGTTTCTGGAGAGAGG - Intergenic
986647336 5:9930254-9930276 CAGTGCAAATGCATGGAGAGAGG + Intergenic
987168463 5:15225947-15225969 CTGTGAGAATTACTGGAGATTGG - Intergenic
987846857 5:23297773-23297795 ATGGGGAAATAACTGGAGACAGG + Intergenic
988665460 5:33322399-33322421 CTGTGAAAATAACTGGGTGGAGG - Intergenic
989133971 5:38135123-38135145 AAGTGCTGATAACTGGAGAGGGG - Intergenic
990181626 5:53166984-53167006 CTTTGAAAATGACTAGAGAGGGG - Intergenic
990522040 5:56589657-56589679 CTGTGAAAATGACTGGGGAATGG + Intronic
990606600 5:57416890-57416912 TTGTGCAAAAGAATGGAGAGGGG + Intergenic
992352831 5:75948670-75948692 CCATGCAAATATCTGGAGAAGGG + Intergenic
994786258 5:104168246-104168268 CTGTGCAAGTCACTGGATTGTGG - Intergenic
999091142 5:148936948-148936970 TTGTTAAAATGACTGGAGAGAGG - Intronic
999647842 5:153736846-153736868 TTATGCAAATAACTGAGGAGGGG - Intronic
999657964 5:153828995-153829017 GTGTGCAAATAGCTGCAGAAAGG - Intergenic
1002460258 5:179369736-179369758 GTGTGCACATCCCTGGAGAGGGG - Intergenic
1004067047 6:12257518-12257540 CTGTGGAAATATCTGTAGAATGG + Intergenic
1006179509 6:32146144-32146166 CTGGGCAAATACCTGGAGGTGGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006562744 6:34927786-34927808 CTGTGTAAAAAACTGGTCAGAGG + Intronic
1007761032 6:44133871-44133893 CTGTGCAAATAACTGGAGAGAGG + Intronic
1008585075 6:52941356-52941378 TTGTGCAAGAAACTTGAGAGTGG + Intergenic
1009770746 6:68140373-68140395 CTGGGCCAATAACTGGGGATAGG + Intergenic
1012658724 6:101858799-101858821 ATGTGCAAAGAACTGGAGTGTGG - Intronic
1013023760 6:106248442-106248464 CTGTGCGAATATCTAGGGAGAGG - Intronic
1013126731 6:107191493-107191515 CAGTGCTAATCACAGGAGAGAGG + Intronic
1016180578 6:141142731-141142753 ATCTGCAATTTACTGGAGAGAGG + Intergenic
1016417298 6:143846176-143846198 CAGTGCACACAACAGGAGAGAGG + Exonic
1018212758 6:161497963-161497985 CTGATCAAATGACGGGAGAGAGG + Intronic
1023331501 7:39122525-39122547 GTGTGCATATAACAGCAGAGGGG + Intronic
1027571776 7:79877124-79877146 TTGTGCAATTTACTGGAGTGAGG + Intergenic
1028383704 7:90228466-90228488 CTGGGCAAATGACTGGAAGGAGG - Intronic
1028418542 7:90606839-90606861 CTGCCCAAATAACTAGAAAGTGG - Intronic
1031748035 7:125530125-125530147 CTATGTAAATAAATGTAGAGTGG - Intergenic
1032885469 7:136133593-136133615 CTGTGCAAATAAGAAGACAGAGG - Intergenic
1033770417 7:144545023-144545045 CACTGCAAATCACTGGAGAAAGG + Intronic
1035503043 8:104584-104606 CTGTGTCAACAACTTGAGAGTGG + Intergenic
1037242952 8:16798295-16798317 CTGTGCAATTTACCGGAGAGAGG - Intergenic
1039400907 8:37268547-37268569 CTGTGCCAATGATGGGAGAGAGG - Intergenic
1042857536 8:73283241-73283263 TTGTGCAAGTTACTGGAGAAGGG + Intergenic
1043408107 8:79960417-79960439 CTTTGCAAATAATTGTAGATGGG - Intronic
1045302238 8:100921831-100921853 CTCTGAAAATCACTAGAGAGTGG - Intronic
1046085156 8:109424751-109424773 CAGTGCTAATCACTGCAGAGAGG - Intronic
1046550257 8:115706956-115706978 ATATCCAAATACCTGGAGAGTGG - Intronic
1049069305 8:140344735-140344757 ATGTGCAGAAGACTGGAGAGAGG + Intronic
1052000643 9:23275511-23275533 CTCAGCAAATAACTGGACATGGG + Intergenic
1052832921 9:33230257-33230279 GTGTGCACTTAACTGGAGTGGGG - Intronic
1055139721 9:72862586-72862608 CTTTGCAAATACGTGAAGAGAGG - Intergenic
1056311447 9:85345734-85345756 TTGTACAAATCACTGGAGAAGGG - Intergenic
1057251616 9:93507909-93507931 TTATGGAAATGACTGGAGAGAGG - Intronic
1060825455 9:126685094-126685116 ACGCACAAATAACTGGAGAGTGG + Intronic
1061876298 9:133545821-133545843 CTGTGCATATACCTGGAAACAGG + Intronic
1185868522 X:3643794-3643816 TTGTGCAAAGAACTTGAGAGTGG - Intronic
1190441372 X:50478088-50478110 CTGTGAAAATATCTGGGGAAAGG + Intergenic
1190584394 X:51923782-51923804 CTGGGCAAACAGCTGGCGAGTGG - Intergenic
1191971084 X:66817029-66817051 CTGTGAAAATATCTGGGGAAAGG + Intergenic
1191974257 X:66852610-66852632 CAATGTAAATAAATGGAGAGAGG - Intergenic
1195294896 X:103466341-103466363 CTGTGGAAGAAACTGGAGAGTGG - Intergenic
1195880702 X:109590023-109590045 CTGTGCAAATATCTATAAAGGGG - Intergenic
1196024760 X:111029858-111029880 ATCTGCAATTAACTGGAGAGAGG + Intronic
1196941912 X:120785420-120785442 CTGTGCCAATTACTAGAGACTGG - Intergenic
1197260441 X:124311848-124311870 ATGTGCATATGCCTGGAGAGAGG + Intronic
1197884167 X:131200668-131200690 CTTTGCACATGAGTGGAGAGGGG + Intergenic
1198208788 X:134496629-134496651 CTCTTCCAATAAATGGAGAGAGG - Intronic
1200795692 Y:7339239-7339261 TTGTGCAAAGAACTCGAGAGTGG + Intergenic