ID: 1007761268

View in Genome Browser
Species Human (GRCh38)
Location 6:44135003-44135025
Sequence CAGCAGTGCCTGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 413}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007761268_1007761282 26 Left 1007761268 6:44135003-44135025 CCCTCTTCCCTCAGGCACTGCTG 0: 1
1: 0
2: 6
3: 43
4: 413
Right 1007761282 6:44135052-44135074 GGCCTGGGACTATGGGCGGCTGG 0: 1
1: 0
2: 1
3: 10
4: 206
1007761268_1007761281 22 Left 1007761268 6:44135003-44135025 CCCTCTTCCCTCAGGCACTGCTG 0: 1
1: 0
2: 6
3: 43
4: 413
Right 1007761281 6:44135048-44135070 AGGTGGCCTGGGACTATGGGCGG 0: 1
1: 0
2: 1
3: 23
4: 240
1007761268_1007761274 5 Left 1007761268 6:44135003-44135025 CCCTCTTCCCTCAGGCACTGCTG 0: 1
1: 0
2: 6
3: 43
4: 413
Right 1007761274 6:44135031-44135053 ATTCTCTATCCTCCGGAAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 63
1007761268_1007761272 -2 Left 1007761268 6:44135003-44135025 CCCTCTTCCCTCAGGCACTGCTG 0: 1
1: 0
2: 6
3: 43
4: 413
Right 1007761272 6:44135024-44135046 TGTTCTTATTCTCTATCCTCCGG 0: 1
1: 0
2: 1
3: 20
4: 271
1007761268_1007761276 11 Left 1007761268 6:44135003-44135025 CCCTCTTCCCTCAGGCACTGCTG 0: 1
1: 0
2: 6
3: 43
4: 413
Right 1007761276 6:44135037-44135059 TATCCTCCGGAAGGTGGCCTGGG 0: 1
1: 0
2: 0
3: 4
4: 73
1007761268_1007761280 19 Left 1007761268 6:44135003-44135025 CCCTCTTCCCTCAGGCACTGCTG 0: 1
1: 0
2: 6
3: 43
4: 413
Right 1007761280 6:44135045-44135067 GGAAGGTGGCCTGGGACTATGGG 0: 1
1: 0
2: 1
3: 18
4: 212
1007761268_1007761273 2 Left 1007761268 6:44135003-44135025 CCCTCTTCCCTCAGGCACTGCTG 0: 1
1: 0
2: 6
3: 43
4: 413
Right 1007761273 6:44135028-44135050 CTTATTCTCTATCCTCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 102
1007761268_1007761275 10 Left 1007761268 6:44135003-44135025 CCCTCTTCCCTCAGGCACTGCTG 0: 1
1: 0
2: 6
3: 43
4: 413
Right 1007761275 6:44135036-44135058 CTATCCTCCGGAAGGTGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 74
1007761268_1007761279 18 Left 1007761268 6:44135003-44135025 CCCTCTTCCCTCAGGCACTGCTG 0: 1
1: 0
2: 6
3: 43
4: 413
Right 1007761279 6:44135044-44135066 CGGAAGGTGGCCTGGGACTATGG 0: 1
1: 1
2: 0
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007761268 Original CRISPR CAGCAGTGCCTGAGGGAAGA GGG (reversed) Exonic
900394593 1:2448001-2448023 CCGCAGTGCCTGTGGGTGGAGGG + Intronic
900428729 1:2592284-2592306 CACCAGTGCCTCAGGGGAGGGGG - Intronic
900439543 1:2646816-2646838 CAGCAGATCCTGAGGGAAGGTGG - Intronic
900484378 1:2914504-2914526 CAGCAGGCCCTGAAGGAAAAGGG - Intergenic
900635542 1:3663144-3663166 CACCCATGCCTGAGGGGAGAAGG + Intronic
900917750 1:5650533-5650555 TAGCGGGGCCTGGGGGAAGATGG + Intergenic
901198078 1:7451430-7451452 CAGCTCTGCCTGGGGGATGAGGG + Intronic
902242821 1:15100178-15100200 CAGGAGTGCCTGGAGAAAGAGGG + Intronic
903049377 1:20589397-20589419 CAGCGGAGACTGGGGGAAGAAGG - Intronic
903050619 1:20598029-20598051 CAGCATGGCCTGAGCTAAGATGG - Intronic
904008789 1:27378307-27378329 CAGGAGAGCCTGAGAGAGGAAGG + Intergenic
904260212 1:29283731-29283753 CTGCAGTGCCTTAGGAAAGGGGG - Intronic
904640816 1:31926816-31926838 TAGCAGTGCCAGAGGGAGGGGGG + Intronic
905369060 1:37473558-37473580 CACGAGTGACTGAGGGCAGAGGG - Intergenic
905947934 1:41919352-41919374 CAACAGTGCCTGAAGGGAGTGGG + Intronic
906085993 1:43135293-43135315 AAGCAGTGCCTGTTGGAGGAGGG - Intergenic
907333426 1:53685873-53685895 GAGCAGTTCCTGAGGCCAGATGG - Intronic
907393671 1:54175020-54175042 CAGCAGAGGCACAGGGAAGAGGG + Intronic
907866919 1:58407476-58407498 CAGCATTGCCTGGGGAAAGGGGG - Intronic
908050727 1:60227043-60227065 CAGCAGCTACTGAGGAAAGAAGG + Intergenic
908136611 1:61139694-61139716 TAGCAGTGCCTGAAGGCAGGAGG - Intronic
909064713 1:70921358-70921380 AAGCATTGCCTGAGGCAAGATGG - Intronic
909113518 1:71507642-71507664 CAGCAGTGGCTGTTGGAAGGGGG - Intronic
910071000 1:83213387-83213409 GAGCAGTGGCTGAGGGGAGGAGG + Intergenic
911685565 1:100773046-100773068 CACCAGGGGCTAAGGGAAGAAGG - Intergenic
912474925 1:109929129-109929151 GTGCAGCCCCTGAGGGAAGAGGG - Exonic
912823472 1:112885540-112885562 CAGCACTGGCAGAGGGGAGAAGG + Intergenic
913137878 1:115910385-115910407 CAGCAGGGCCTCTGGGAATATGG - Intergenic
914407473 1:147390047-147390069 CAGCAGTGCTTAGGGGAAGAGGG - Intergenic
914827080 1:151144350-151144372 CAGCAGCTCCTGAGGGCAGGGGG - Intronic
915597922 1:156905906-156905928 GGGCAGTGGCTGAGGGAAGTGGG - Intronic
915600801 1:156922116-156922138 CAGCAGTGCCTGAGAGGTTAGGG + Intronic
916519839 1:165553717-165553739 CTGCAGTCCCAGAGGGCAGAGGG - Intronic
916542402 1:165769441-165769463 AAGCAGTGCCTTAGGGGAGTAGG + Intronic
918320510 1:183359718-183359740 CAGCAGTGGGAGAGGGAAAATGG + Intronic
918401250 1:184164726-184164748 CTGCAGTGTCTGTGGTAAGAAGG + Intergenic
919790259 1:201285939-201285961 CCGCAGAGTCTGAGGGTAGAGGG - Intronic
919791821 1:201296146-201296168 CAGGAGAGGCTGTGGGAAGAGGG + Intronic
920708856 1:208275874-208275896 CAGTTGTGCCCAAGGGAAGAGGG - Intergenic
921279611 1:213552883-213552905 CAGTAGTGCTTGAAGGTAGAAGG - Intergenic
921948293 1:220904149-220904171 CAGCTGTGGCTGTGGGTAGAGGG + Intergenic
922240315 1:223751293-223751315 TAGAAGTGCCTGGGGGAAGGTGG - Intronic
922388749 1:225115799-225115821 CAGCAGTGCCTGATACAAAATGG - Intronic
922739008 1:228005346-228005368 CCGCAGTGCCTGGGAGAAGCGGG + Intergenic
923538210 1:234869345-234869367 GAGCAGTGCCTGGAGGAAGCAGG - Intergenic
923935165 1:238751785-238751807 ATGCAGTCACTGAGGGAAGAGGG - Intergenic
923986390 1:239387039-239387061 CAGCAGCGCTTCTGGGAAGACGG + Intronic
924325896 1:242893554-242893576 CAGCAGTCCCTGAAGGTAGCTGG - Intergenic
924503402 1:244657777-244657799 CAGCAGTATGTGAAGGAAGATGG + Intronic
1062770144 10:92558-92580 CAGCTGTGCCTGGGGGGACAAGG + Intergenic
1063835203 10:10004316-10004338 CAGCAGAACCTCTGGGAAGAGGG - Intergenic
1064430806 10:15268328-15268350 CTGCAGTGCCTGAGGGGACATGG + Intronic
1064458952 10:15514782-15514804 TAGCAGTGCCTGTGGGCAGGTGG + Exonic
1065007577 10:21394014-21394036 CAGCCGGGTCTCAGGGAAGATGG + Intergenic
1066055188 10:31674150-31674172 CCTCAGAGCCTCAGGGAAGAGGG + Intergenic
1067479108 10:46584012-46584034 CAACAGTGACTCAGGGAGGAGGG + Intronic
1067615631 10:47757789-47757811 CAACAGTGACTCAGGGAGGAGGG - Intergenic
1068938395 10:62657752-62657774 CAACAGTGCCAGAGGGAGGCTGG + Intronic
1069255211 10:66323869-66323891 CAGCAGAGAAAGAGGGAAGAGGG + Intronic
1069593582 10:69656421-69656443 CACCACTGCCCCAGGGAAGAGGG - Intergenic
1069661123 10:70124081-70124103 CAGCAGTGCCTGATTTGAGATGG - Exonic
1069671874 10:70212995-70213017 CATCAGGGACTGAGGGAAGGGGG + Intronic
1070148465 10:73791365-73791387 CAGCAGTGCCAGTGGGCACACGG + Exonic
1070931007 10:80260569-80260591 GAGCAGTCCCTGAGACAAGATGG + Intergenic
1071370939 10:84951045-84951067 GAGCAGAGTCTGAGAGAAGACGG + Intergenic
1071435670 10:85646613-85646635 TACCAGTGCCAGAGGGAGGAAGG - Intronic
1071473892 10:86008199-86008221 GAGCAGGGCCTTAGGAAAGAAGG + Intronic
1071730433 10:88243292-88243314 CAGCAGAGCTTCAGGGAAAATGG - Intergenic
1072466101 10:95663722-95663744 CAACTGTGCCTGAGGGCTGATGG + Exonic
1072610397 10:97013981-97014003 CAGCAGTGTCTGGGGGAGGTGGG - Intronic
1073541838 10:104321381-104321403 CAACAGGGGCTGAGGGAAGATGG + Intronic
1074275400 10:111996961-111996983 CAGCTGTGCCTATGGGAAGGGGG - Intergenic
1075620274 10:123922337-123922359 CAGCAGAGCCTAAGGGAATAAGG + Intronic
1075871702 10:125775786-125775808 CAGCAGTGTCGGACGGAAGATGG + Exonic
1076215084 10:128686969-128686991 CATCAGTGCCTGTGGAAGGAAGG + Intergenic
1076474560 10:130743186-130743208 CTGCAGTGCCTGATGGGGGAAGG - Intergenic
1076947799 10:133664391-133664413 CAGCAGTGTGTGAGGGGAGATGG + Intergenic
1076954704 10:133740570-133740592 CAGCAGTGTGTGAGGGGAGATGG + Intergenic
1077077297 11:707442-707464 CAGCAGGGCAGGAGGGTAGAGGG - Intronic
1077541042 11:3146653-3146675 CAGCTGTGCCTGAGTGCAGGGGG + Intronic
1077635705 11:3840510-3840532 GAGAAGTGCGTGAGGGGAGAGGG - Intronic
1077920432 11:6638015-6638037 CACTAGTGCCTGAAGCAAGAGGG - Intronic
1077955942 11:7020184-7020206 GAGCTGTGCTTGAAGGAAGAGGG - Exonic
1078267593 11:9766541-9766563 CAGCAGTGCCTGATGGAACTGGG - Intergenic
1078535906 11:12173703-12173725 TAGCAGGGGCTGAGGGAAGAAGG - Intronic
1080645976 11:34187838-34187860 GAGCAGGGACTGAGGGAAGGAGG + Intronic
1081651547 11:44827352-44827374 CAGCAGGGGCTGAGGGAGAAAGG - Intronic
1081702384 11:45159913-45159935 CAGGAGTCACTGGGGGAAGATGG + Intronic
1082812070 11:57484453-57484475 CAGCTGAGCCTGGGTGAAGAAGG + Intergenic
1083326459 11:61875637-61875659 CAGCAGTGCCTGCGGTGAGCAGG - Intronic
1083365347 11:62138757-62138779 CAGCTGAGCCAGAGGTAAGACGG + Exonic
1084974737 11:72790532-72790554 GAGCAGGGGCTGGGGGAAGAGGG - Intronic
1085386348 11:76160384-76160406 CAGCAGGGGCTGGGGGATGAGGG + Intergenic
1087369311 11:97261629-97261651 CAGAGGTGCCCGAGGGAAGATGG - Intergenic
1087582132 11:100070547-100070569 CAACAGTACCTGAGGTGAGAGGG - Exonic
1088011402 11:105005665-105005687 CAGCAGAGGCTGTGGCAAGAAGG - Intronic
1088469296 11:110176537-110176559 CAGCAGTGACTGTAGGCAGATGG + Intronic
1089453475 11:118612390-118612412 CAGCATTTTCTGAGGGAGGAGGG - Intronic
1090205944 11:124884500-124884522 CAGCAGTGGCTGCTGGGAGAGGG - Exonic
1090528179 11:127560268-127560290 CAGCAGAGCCTGTTGGCAGATGG - Intergenic
1091201515 11:133784303-133784325 TAGCATTGCCTGAGGGAAGGGGG + Intergenic
1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG + Intronic
1092087993 12:5780733-5780755 TCGCAGTTCCTGAGGGCAGAGGG - Intronic
1092998536 12:13973882-13973904 CATTGGTGCCTAAGGGAAGATGG - Intronic
1093557423 12:20492607-20492629 GAGCAGTGCCTGTGGGAAAGGGG + Intronic
1095387259 12:41665687-41665709 CACCAGGGCCTGTGGGAGGATGG + Intergenic
1096510220 12:52123735-52123757 CAGCTTTGGCTGAGGGAGGATGG - Intergenic
1096521318 12:52186299-52186321 CCTCAGTGCTGGAGGGAAGAGGG - Intronic
1096744162 12:53714685-53714707 CAACTGTACCTGAGGGAAGAGGG + Exonic
1097250485 12:57629984-57630006 CAGCAGGGCCAGAGGGAGAAAGG - Intronic
1098439005 12:70498798-70498820 AAGCATTGCCTGATGTAAGATGG + Intergenic
1098998291 12:77147218-77147240 CAGCAGTAGCTGAGCAAAGATGG - Intergenic
1101318688 12:103653502-103653524 CTGCAGTGCATGTGTGAAGATGG + Intronic
1102717931 12:114990245-114990267 GAGCAGGGCCTGAAGGAAGAGGG + Intergenic
1102731405 12:115114160-115114182 AAACAGTGTCTGGGGGAAGAGGG - Intergenic
1104655804 12:130572999-130573021 CAGCAGTGGCTGTGGGAAGAAGG - Intronic
1105254189 13:18729891-18729913 CAGCAGTGCTTGAGGGTGGGGGG - Intergenic
1105280994 13:18962520-18962542 CTGCGGAGCCTGAGGGCAGACGG + Intergenic
1105635550 13:22212209-22212231 CAGCAGGGCCTGCAGGATGATGG + Intergenic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1107436915 13:40388504-40388526 TAGCAGAGCCTGAGGCAAAAGGG - Intergenic
1107726891 13:43308026-43308048 CAGCAGTGAGAGAGGGAAGCAGG - Intronic
1108309742 13:49176467-49176489 CAGCAGTGCCTGTTGGAGGGTGG + Intronic
1111128021 13:83936956-83936978 CAGCATTGACTGAGGGAAACAGG - Intergenic
1111919070 13:94391801-94391823 CAGCAGGGCCTGGGGGTAGAGGG - Intronic
1111985373 13:95060905-95060927 CACCAGGGGCTGAGGGAAGGTGG - Intronic
1112306031 13:98274404-98274426 CAGAAGAGACTGAGGGAGGAAGG + Intronic
1112717660 13:102205128-102205150 CAGCAGAAACTGAGAGAAGAAGG + Intronic
1113921476 13:113915539-113915561 CAGCTGTGCCTCAGCGAGGAGGG + Intergenic
1113938225 13:114006141-114006163 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938260 13:114006251-114006273 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938321 13:114006437-114006459 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938381 13:114006623-114006645 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938429 13:114006771-114006793 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938464 13:114006881-114006903 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938499 13:114006991-114007013 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938534 13:114007103-114007125 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938630 13:114007380-114007402 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938653 13:114007452-114007474 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1114440198 14:22740206-22740228 CAGCAGTGCATGAGGACAGCTGG - Intergenic
1114560952 14:23589937-23589959 GAGCAGAGGATGAGGGAAGAAGG + Intergenic
1115995572 14:39192441-39192463 CAGCAGTGTGTGTAGGAAGAGGG + Intergenic
1118480358 14:66158671-66158693 CAACAGTGTCTCAGGGAATAGGG + Intergenic
1120831411 14:89000739-89000761 CAGCAGTTCCTGTAGGGAGAAGG + Intergenic
1122282904 14:100634692-100634714 GAGCAGTTCCTGGGGGAAGCGGG + Intergenic
1123133001 14:106002001-106002023 CGCCAGGGCCTGAGGGAACAGGG + Intergenic
1123149983 14:106171217-106171239 CACCAGGGCCTGAAGGAACAGGG + Intergenic
1123164210 14:106309865-106309887 TACCAGGGCCTGAAGGAAGAGGG + Intergenic
1123196276 14:106619380-106619402 CACCAGGGCCTGAAGGAACAGGG + Intergenic
1123204175 14:106695563-106695585 CACCAGGGCCTGAAGGAACAGGG + Intergenic
1123209183 14:106742031-106742053 CACCAGGGCCTGAAGGAACAGGG + Intergenic
1123583028 15:21732447-21732469 CGCCAGGGCCTGAGGGAACAGGG + Intergenic
1123619678 15:22175044-22175066 CGCCAGGGCCTGAGGGAACAGGG + Intergenic
1125591409 15:40856756-40856778 CCACAGAGCCTGGGGGAAGAAGG - Exonic
1126857690 15:52854777-52854799 CAGCAGTGCCATGGGGCAGAAGG + Intergenic
1126859596 15:52871041-52871063 CAGAAGTGCCTGGAGAAAGAAGG - Intergenic
1128819546 15:70639454-70639476 CAACAGATCCTGAGGGAAGTGGG + Intergenic
1129385025 15:75191672-75191694 CAGCAGTGGCACAGGGCAGAAGG - Intergenic
1129692419 15:77721337-77721359 AGGCAGTGGCTGGGGGAAGAGGG - Intronic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1132161506 15:99547313-99547335 CAGCTGTGGCTGATGGGAGATGG - Intergenic
1132291306 15:100705628-100705650 CAGCTGTGTGGGAGGGAAGAGGG + Intergenic
1132552451 16:559186-559208 CAGGGGTGCCTTGGGGAAGAAGG - Intergenic
1132730404 16:1358187-1358209 CACCAGCGCCTGGGGGAAGAGGG - Intronic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1134297940 16:12963119-12963141 CAGAGGTGCCTGAGGGAAGCAGG + Intronic
1135424460 16:22325442-22325464 CAGCAGAGCCTCAGGGACGGAGG + Intronic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1136186595 16:28592132-28592154 CAGCCATGCCTGGGGGAGGAAGG + Exonic
1136189216 16:28605925-28605947 CAGCCATGCCTGGGGGAGGAAGG + Exonic
1136317816 16:29464449-29464471 CAGCCATGCCTGGGGGAGGAAGG - Exonic
1136343020 16:29657167-29657189 CAGCAGTGACGGGGCGAAGAGGG + Intergenic
1136432391 16:30203794-30203816 CAGCCATGCCTGGGGGAGGAAGG - Exonic
1136694205 16:32062319-32062341 CACCAGGGCCTGAAGGAACAGGG - Intergenic
1136794702 16:33005583-33005605 CACCAGGGCCTGAAGGAACAGGG - Intergenic
1136995095 16:35183580-35183602 CAGCAGACCCTGAGAGAAGAAGG + Intergenic
1137270452 16:46899545-46899567 CAGCAGTGGCTGTGGGAGGGAGG - Intronic
1137887832 16:52125968-52125990 CAGCAGAGTCTGGAGGAAGAAGG + Intergenic
1138537636 16:57668281-57668303 CAGCAGAGCCTGGGGCCAGAGGG + Exonic
1138605179 16:58083987-58084009 CTGCAGTGGCTAAGGGAAGGCGG + Intergenic
1139485361 16:67253153-67253175 CAGCTATGCCTCAGGGGAGACGG - Intronic
1139548596 16:67661235-67661257 CAGCAGTGGAGGAAGGAAGACGG - Intronic
1139595826 16:67957788-67957810 CAGCAGGGTCTGTGGGAAGGAGG + Exonic
1139692265 16:68648772-68648794 AAGCAGGGCCTGAGTGGAGAGGG + Intronic
1141103165 16:81212687-81212709 CAGCAGTGCCTTGGTGAGGAAGG + Intergenic
1141496146 16:84411022-84411044 CAGGAGTGACTCTGGGAAGAGGG + Intronic
1141669745 16:85485537-85485559 CAGCCGGGCCTGCGGGATGAAGG - Intergenic
1141907987 16:87040378-87040400 CAGCAGTGCCTGTGGGAATGTGG - Intergenic
1142122663 16:88394730-88394752 GTGCAGTGCCTGAGGGAACAGGG + Intergenic
1203096965 16_KI270728v1_random:1267233-1267255 CACCAGGGCCTGAAGGAACAGGG - Intergenic
1142611247 17:1110007-1110029 CAGCAGTGCCTGTGAGTAGGTGG - Intronic
1143712646 17:8744946-8744968 CAGAAGTTCCTGAGGGCAAAGGG - Intronic
1143777715 17:9210231-9210253 CAGGAAGGTCTGAGGGAAGAGGG - Intronic
1143965687 17:10755266-10755288 GAGCTGTAGCTGAGGGAAGAGGG - Intergenic
1144275802 17:13667077-13667099 CTGCTGTGCCTGAGGTCAGATGG - Intergenic
1144493706 17:15734456-15734478 CACAACTGCCTGAGGGCAGAGGG - Intronic
1144906559 17:18642223-18642245 CACAACTGCCTGAGGGCAGAGGG + Exonic
1145938009 17:28726333-28726355 CAGCAGCGCCTGAGGGGCGGGGG - Intronic
1147649587 17:42054302-42054324 CAGCAAGTCCTGAGGCAAGAGGG - Intronic
1147948809 17:44095692-44095714 CAGCTGTGCCTGGGGGGAGGGGG + Intronic
1147966922 17:44199030-44199052 CAGCAGTGCCGCAGGGACGGGGG - Intronic
1147995201 17:44356344-44356366 AGCCATTGCCTGAGGGAAGAGGG + Exonic
1148466206 17:47866682-47866704 CATGCGTGCCTGGGGGAAGATGG - Intergenic
1148835761 17:50464949-50464971 CAGCAGAGGCTGTGGGGAGAAGG + Exonic
1149682721 17:58517366-58517388 CTGCACTGCCTGAGGAAAGCAGG - Intronic
1149981819 17:61316968-61316990 CATCAGTGTCTGAGGTGAGAGGG - Intronic
1150783857 17:68146819-68146841 CAGCATTACCTCAGGGATGAGGG + Intergenic
1150800505 17:68278252-68278274 CTGAAGTGCCTGATGGAGGATGG - Exonic
1151677426 17:75605850-75605872 CAGCAGGACCTGTGGGTAGAGGG - Intergenic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1153244543 18:3060926-3060948 CAGAAGGGCCTGGGGGAACAGGG + Intergenic
1155433367 18:25785609-25785631 CAGCAGAGGCAGAGGGGAGAGGG - Intergenic
1157322527 18:46645592-46645614 CAGCAGTGGCTGCCAGAAGAAGG - Intronic
1158619640 18:59021555-59021577 CAGCTGTGGGTGAGGAAAGATGG - Intergenic
1159687304 18:71438402-71438424 GAGTAGGCCCTGAGGGAAGAAGG + Intergenic
1159801067 18:72899740-72899762 CAGCAGTGCCAGAGAGAAGATGG - Intergenic
1160434560 18:78836427-78836449 CAGCTGTGCCTGGGGACAGAAGG - Intergenic
1160757479 19:765194-765216 GAGCAGAGACTGAGGGAGGAGGG + Intergenic
1160919238 19:1512141-1512163 CAGCAGAGCCTGAAGGCAGGTGG + Intronic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1162111188 19:8400547-8400569 CAGATGTACCTGAGGGATGAAGG - Intronic
1163644161 19:18478893-18478915 CAGCAATGCCTTTGGGAAAAGGG + Intronic
1164919323 19:32077108-32077130 CAGCACTGCCAGAGGGAACTCGG + Intergenic
1165040096 19:33062978-33063000 CAGCAGCACCTGGGGGAAAATGG - Intronic
1165226227 19:34357198-34357220 CAGCAGTGCTGGAGGCCAGAGGG + Intergenic
1165690129 19:37856425-37856447 CAGGAGATCCTGTGGGAAGAGGG + Intergenic
1165833995 19:38743593-38743615 CACCTGGGTCTGAGGGAAGAGGG - Intronic
1165900796 19:39168383-39168405 CCACAGTGCCTGTGGGAGGAGGG - Intronic
1166371915 19:42306676-42306698 CAGGCGTGCCAAAGGGAAGAAGG - Intronic
1166752366 19:45170400-45170422 GTGCTGAGCCTGAGGGAAGAGGG + Intronic
1167019318 19:46861845-46861867 CAGCAGTGCCTGGCCGAACAGGG - Intergenic
1167257851 19:48442043-48442065 CACCAGGGTCTGAGGGAGGAAGG + Intronic
1167272029 19:48511322-48511344 CAGCAGGGCCTGTGGGAGGGAGG - Intronic
1167327897 19:48836573-48836595 GAGGAGTGTCTGAGGGAGGAGGG - Exonic
1167414537 19:49363144-49363166 CTTTGGTGCCTGAGGGAAGATGG + Intronic
1167489987 19:49786957-49786979 CAGCAGTGACTGGGGCACGAAGG + Intronic
1168246455 19:55115060-55115082 GAGCAGGGCCTTAGGGAAGCGGG + Intronic
925115009 2:1371275-1371297 CAGCAGTGCCAGAGGAATCACGG + Intergenic
925169426 2:1741959-1741981 AGGCAGGGACTGAGGGAAGAGGG - Intronic
925507341 2:4583279-4583301 CAGCAGTGCCTGAATAAGGATGG + Intergenic
925545103 2:5007236-5007258 CAGAAGTGCCTAAGGAAACATGG + Intergenic
925715783 2:6783019-6783041 GTGCAGTGCCTGAGTGCAGATGG - Intergenic
926103172 2:10133593-10133615 CAGCAGTCCCTGAGTATAGAGGG + Intergenic
926606503 2:14903870-14903892 CAGCAGGGCCTGAGGGTGGGGGG + Intergenic
926692488 2:15747260-15747282 CACGAGAGCCTGAGGGAAGAGGG + Intergenic
926819910 2:16840647-16840669 CAGCAGTACCTGGGGGAAGAAGG - Intergenic
927063039 2:19442178-19442200 CAGCAGTGCCTCAGGCCTGAAGG - Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
929147895 2:38722466-38722488 CAGCAGTGCCTGGCAGATGAGGG - Intronic
929588679 2:43131637-43131659 CAGCAGGGACTGAGGGAGAAGGG - Intergenic
929779941 2:44951190-44951212 CGGAAGGGTCTGAGGGAAGATGG + Intergenic
930166547 2:48209197-48209219 AAGCAGTGCCTGTGGTAAAAAGG - Intergenic
930351289 2:50258613-50258635 CATCTGTGACTCAGGGAAGACGG - Intronic
930942946 2:57035672-57035694 CAGCAGTGCTTGAGGTAAAGGGG - Intergenic
932198436 2:69804519-69804541 CATCGGTGCCTGGGGGAAGAAGG - Exonic
932749934 2:74365099-74365121 TAGCAATGCCTGAAGGAGGAGGG + Exonic
933781298 2:85803391-85803413 CAGCAGGGCCTGTCAGAAGAGGG - Intergenic
935855679 2:107270344-107270366 GAGCAGAGTCTGAGGGAAGAGGG + Intergenic
936269307 2:111036595-111036617 GAGCAGTGCCTTTGGGAAAAAGG + Intronic
936600351 2:113889630-113889652 CTCCAGTGCCTGAGAGAAAACGG - Intergenic
936667109 2:114609464-114609486 CAGCGGTGCCTGTGTGAAGTGGG + Intronic
936889283 2:117350287-117350309 CAGAATTGCCTCAAGGAAGATGG + Intergenic
937905980 2:127053054-127053076 CAGGAGGGCCTCAGGGTAGAAGG - Intronic
939408663 2:141795411-141795433 CAGCAGCCCTTGAGGGAAGATGG + Intronic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
940579105 2:155553522-155553544 TAGCATTTCCTGAGGAAAGAGGG + Intergenic
940831765 2:158474631-158474653 CACCAGTGCCCTAAGGAAGACGG + Intronic
941133493 2:161684044-161684066 TGTCAGGGCCTGAGGGAAGAAGG - Intronic
941983390 2:171485353-171485375 CAGCAGTTCCTGGGGAAGGAAGG - Intergenic
942345784 2:175001507-175001529 CAGAAGGGTCTGAGGAAAGATGG + Intronic
943784987 2:191867566-191867588 GAGAAATCCCTGAGGGAAGAAGG + Intergenic
945840040 2:214876802-214876824 CAGCACTGCCTGATAGAAGCTGG + Intergenic
945944293 2:215980176-215980198 AAGCAGTGCCTGGAGGAAAAGGG - Intronic
946300953 2:218823798-218823820 CACCAGTGCCTGAAGGATGTCGG + Exonic
947669583 2:231927733-231927755 AAGCTGTGCCTGAGGCAGGAAGG + Intergenic
948421301 2:237862026-237862048 CAGCATTCCCTGAGTGAAGATGG - Intronic
948789513 2:240370083-240370105 CAGCTGTGTCTGGGGGAGGAGGG + Intergenic
1169425927 20:5497402-5497424 CAGCAGGAACTGAGAGAAGAAGG + Intergenic
1170129794 20:13007068-13007090 CAGCAGTGCCTGATGCCAAATGG + Intergenic
1171781046 20:29417987-29418009 CAGCAGTGGGGGAGAGAAGAAGG - Intergenic
1171874049 20:30555321-30555343 CACCAGGGCCTGAGTGAAGCAGG - Intergenic
1173013240 20:39201300-39201322 CAGAAATGCCTGATGGAGGAAGG - Intergenic
1174068420 20:47882856-47882878 CAGCAGTACCTGAAGGCAGCTGG - Intergenic
1174359606 20:50019763-50019785 CAGTAGTTGCTCAGGGAAGAAGG + Intergenic
1175402243 20:58707332-58707354 CAGAAGAGCCTGGGGGCAGAGGG - Intronic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1178496484 21:33090539-33090561 ATGCAGTGCCTGAGGGAAGAAGG - Intergenic
1178994555 21:37386846-37386868 CAACAGTGCCCATGGGAAGAAGG + Intronic
1179126399 21:38595036-38595058 CAGGAGAGCCCGAGGCAAGAGGG + Intronic
1179317799 21:40260375-40260397 CAGCTGTGGCTGAGGCAGGAAGG - Intronic
1179910663 21:44446076-44446098 CAGCAATGGGTGAGAGAAGAGGG + Intergenic
1180926120 22:19556165-19556187 CTGCAGGGCCAGAGGCAAGATGG - Intergenic
1181429012 22:22866156-22866178 CAGCTGTGCATGAGTGAGGAGGG - Intronic
1181953714 22:26573110-26573132 GAGCAGTCCCTGGAGGAAGAAGG - Intronic
1182473976 22:30565858-30565880 CAGCAGTGCTGAAGGGAGGATGG - Intronic
1183121338 22:35732316-35732338 AAGCAGCCACTGAGGGAAGAGGG + Intergenic
1183151050 22:36037661-36037683 CAGCAGGGGCTGAGGAGAGAGGG - Intergenic
1183323809 22:37180713-37180735 CATCAGTGTCTGAGGGCAGCTGG + Exonic
1183786805 22:40033979-40034001 TAGCTGAGCCTGAAGGAAGAGGG - Exonic
1183978718 22:41527596-41527618 AAGCAGGGCCTGCGGGAAGCCGG - Exonic
1184320540 22:43739286-43739308 CAAAAGTGCCTCAAGGAAGAAGG - Intronic
1184652097 22:45924101-45924123 CAGCCGGGCCTGATTGAAGATGG + Intronic
949884405 3:8682027-8682049 TAGCAGAGCCTAAGGGCAGAAGG + Intronic
950032079 3:9860020-9860042 CAGCAGCGCCTGAAGGGAGGTGG + Intergenic
950201945 3:11050720-11050742 CATCAGGGCATGAGGGAAGCAGG - Intergenic
950747573 3:15102570-15102592 GGGCAGTGTCTGAGGGAAGCAGG + Intergenic
951733533 3:25837021-25837043 CAGCAGGGACTGAGGGCAGCAGG - Intergenic
951737128 3:25879571-25879593 TAGCAGTGGCTGAGGGGAAAAGG - Intergenic
952906658 3:38143623-38143645 CAGGAGTCCCTGAGGGCACAGGG - Intergenic
953367007 3:42353623-42353645 CAGAAGTTCCTGAGAGAACAGGG + Intergenic
953681894 3:45045474-45045496 CAACAGTGCCTGTGGCAAAAAGG + Intergenic
957128860 3:76198146-76198168 CACCATGTCCTGAGGGAAGAGGG - Intronic
957934363 3:86923345-86923367 AAGCAGGGCCTGGGGGGAGATGG - Intergenic
960152215 3:114261948-114261970 AAGCATTGCCTGAGGCAGGATGG + Intergenic
961489663 3:127245844-127245866 CAGAAGTGCCTGGTGGAAAAGGG + Intergenic
961784831 3:129341457-129341479 CAGCACTGCCTGAAGGGAGGTGG + Intergenic
961785386 3:129344112-129344134 CAGCAGCGCCTGGAGGGAGACGG + Intergenic
962367768 3:134797167-134797189 CAGCAGTCCCTGAGGGAAGCAGG - Intronic
962829122 3:139124118-139124140 AATCAGTGCCTGTGTGAAGATGG + Intronic
963084621 3:141425529-141425551 CTGCAGTGCCTGCCAGAAGAAGG - Intronic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
966774660 3:183533379-183533401 CTGGGGAGCCTGAGGGAAGAGGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968425199 4:518661-518683 AAGTAGTGGCTGGGGGAAGATGG + Intronic
968468620 4:765850-765872 CAGAAGTTGCTGGGGGAAGACGG - Intronic
968592959 4:1468746-1468768 CATCAGTGCCTGTGGCAGGAGGG + Intergenic
968871891 4:3246576-3246598 CAGCAGCACCTGAGGGAGAAGGG - Intronic
969227889 4:5811091-5811113 CAGCACTGCAGGAGGGAAGGTGG - Exonic
969258526 4:6019423-6019445 CTTGAGTGCCTGAGAGAAGATGG - Intergenic
969328928 4:6461767-6461789 CAGCACTTTCTGAGGGAAGAGGG - Intronic
969634627 4:8359769-8359791 AAGCATTGCCTGAGGCAGGATGG - Intergenic
969860694 4:10033391-10033413 AAGCAGAGCCGGGGGGAAGAGGG - Intronic
969895330 4:10298632-10298654 CAGCAGTTACTGGGGGAATATGG + Intergenic
970147166 4:13048095-13048117 CAGCACTGGCTGTGTGAAGAGGG + Intergenic
970429638 4:15976942-15976964 GAGCAGTGACTGGGGGAGGAGGG + Intronic
970603519 4:17658845-17658867 GAGCAGCACCTGAGGGAGGAGGG - Intronic
971350269 4:25849512-25849534 TACCAGGGCCTAAGGGAAGAGGG + Intronic
971362164 4:25948147-25948169 CACCAGGGGCTGAGGGGAGAGGG - Intergenic
973975978 4:56262935-56262957 CAGCTGGCCCTAAGGGAAGAGGG + Intronic
974435183 4:61847373-61847395 CAGCAGTGTATGGGGGAGGAGGG + Intronic
974449625 4:62036384-62036406 GAGGAGTGCCTGCGGGAAGTAGG - Intronic
975216858 4:71765577-71765599 CAGCAGTGCCTGGGTGAACGGGG + Exonic
975265077 4:72353936-72353958 AAGCAGTTCCTGAGGGATGTAGG - Intronic
975646833 4:76554122-76554144 CAGCAGTGGCTGAGGTTAAAGGG - Intronic
975693427 4:76988040-76988062 CAGCAGTACCTGATGGGAGAAGG - Intronic
977180335 4:93866196-93866218 CAACATTGCCTGGGGGAGGAGGG - Intergenic
978122858 4:105101848-105101870 CAGCAATCCCTGAGGTAAGGTGG + Intergenic
981982197 4:150807306-150807328 GAGCAGTGCCTGTGAGGAGATGG - Intronic
982205795 4:152996353-152996375 CAGCACTGCCTAGGGGAAGGAGG - Intergenic
982301435 4:153882758-153882780 AAGCAGTGGTTGAGGGAGGAGGG + Intergenic
983416439 4:167461312-167461334 CTGCAGTGCCTGTAGGAATAAGG - Intergenic
984466117 4:180101508-180101530 CAGCTGAGCCTGAGAGAAGCAGG + Intergenic
984499944 4:180546372-180546394 CAGAACTGCTTGAGGGAACACGG - Intergenic
985451252 4:190065190-190065212 CAGAAGTGTGTGAGGGGAGATGG + Intergenic
988492737 5:31718309-31718331 CAGATGGGCCTGGGGGAAGAAGG + Intronic
988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG + Exonic
988695975 5:33623249-33623271 CAGTAGGGCCTGAGGGGAGAGGG - Intronic
989987786 5:50722358-50722380 TAGCTGTGCCCGAGGGGAGAGGG - Intronic
992382842 5:76255744-76255766 CAGCAGAACCTGAGGGGTGAGGG - Intronic
992758601 5:79932222-79932244 TGGCAGAGGCTGAGGGAAGAGGG + Intergenic
992933809 5:81680008-81680030 CAGCAGTGTCTGAGGACAGAAGG - Intronic
993364487 5:87019538-87019560 CAGCAGTGGGTGGGGGAAGCTGG + Intergenic
995247195 5:109947833-109947855 CAGGAATGGCTGAGGGAATAGGG + Intergenic
996764203 5:127019403-127019425 CATCATTGCCTGAGGGAGGGAGG - Intronic
997699848 5:135889217-135889239 CAGCAGAGCCTCGGGGTAGAGGG - Intergenic
997864465 5:137448887-137448909 AAGCCCTGCCTGAGAGAAGAAGG + Intronic
998367154 5:141638941-141638963 CAGCATTGGCTGAGGGAAGAAGG - Exonic
1000061088 5:157655720-157655742 CAGCATTGCCTGAGGCAAGGTGG - Intronic
1000130261 5:158290416-158290438 CAGCATTGCTTTAGGGAAGGGGG + Intergenic
1001034383 5:168287150-168287172 CAGCGGTCTCTGTGGGAAGAGGG - Intergenic
1001661513 5:173396821-173396843 GAGCTGTCACTGAGGGAAGATGG - Intergenic
1001673624 5:173494405-173494427 CAGCTGTGCCTGAAGGAGGCAGG - Intergenic
1002169117 5:177365711-177365733 CAGCAGGGGCTGGGGGAGGAGGG + Intronic
1002409975 5:179066294-179066316 CAGCAATGCCGTAAGGAAGAGGG - Intronic
1002437081 5:179238314-179238336 GAGCAGTCCCTGAGGGGAGCTGG - Intronic
1002537607 5:179886136-179886158 CAGGAGTGCCAGGGGAAAGAAGG - Intronic
1002779555 6:355911-355933 AAGCTGTGCCTGAGGGCGGAAGG - Intergenic
1002797571 6:487218-487240 CAGCAGTGGCTGCTGGGAGATGG - Intronic
1003148911 6:3532187-3532209 CACCAGGGCCTGGGGGAAGGAGG - Intergenic
1004079637 6:12379371-12379393 CAGCAGTGACTGTGGGTAAATGG + Intergenic
1006523428 6:34585316-34585338 GATCAGTGCCTCAGGGAATAGGG - Intergenic
1007619638 6:43204121-43204143 GAGCAGTGCCTGGGGCAGGAAGG - Intronic
1007761268 6:44135003-44135025 CAGCAGTGCCTGAGGGAAGAGGG - Exonic
1007762476 6:44141116-44141138 CAGCAGGGCTTGAGGGTAGGGGG - Intronic
1008559173 6:52706143-52706165 GAGCACTGCCTGAGGTAGGATGG - Intergenic
1012524561 6:100161526-100161548 AATCAGTGCCTTGGGGAAGAAGG + Intergenic
1013079129 6:106797161-106797183 CAGGACTGCTTGAGGAAAGAGGG + Intergenic
1013760370 6:113510960-113510982 CAGCAGGGGGTGAGGAAAGAGGG + Intergenic
1013961164 6:115902099-115902121 CAGCAGCTCCAGATGGAAGATGG + Intergenic
1015493489 6:133855024-133855046 CAGCACCGCCTGAGGTCAGAGGG - Intergenic
1015958298 6:138621102-138621124 CAGCAGTGTCTGGGGGATGCTGG - Intronic
1016177970 6:141103879-141103901 TAGAAGTGCATGATGGAAGAAGG - Intergenic
1020361293 7:7329525-7329547 CAGCAGTGCCTGGGGGACAAAGG - Intergenic
1022743820 7:33149265-33149287 CCACAGTGCCAGAGGAAAGAAGG + Intronic
1023632320 7:42176863-42176885 AAAAAGTGCCTGAGGGGAGAGGG - Intronic
1023861399 7:44219566-44219588 CAGCAGAGCCTGGGGGTGGATGG - Intronic
1025232906 7:57214629-57214651 TACCAGGGCCTGAGGGAGGATGG + Intergenic
1026231410 7:68487376-68487398 CAGCTGAGCCTGAGAGAAGGAGG - Intergenic
1026672194 7:72400243-72400265 CAGTAGTGCCCAAGAGAAGAGGG - Intronic
1026929905 7:74218037-74218059 GGGCAGGGCCTGAGGGGAGAGGG - Intronic
1027288718 7:76678246-76678268 GAGCAGTGGCTGAGGGGAGCAGG + Intergenic
1028163484 7:87511788-87511810 AAGAAGTGCCTGAGCCAAGATGG - Intronic
1028167592 7:87556431-87556453 TAGCAGTGCAGGAGGGAAGCTGG - Intronic
1031567166 7:123314530-123314552 CAGCAGGGTCTGAAGCAAGAAGG + Intergenic
1033161711 7:139002507-139002529 AAGCATTGCCTGAGGCAAGGTGG - Intergenic
1033321429 7:140343258-140343280 CAGCTGGTCCTGAGGGGAGACGG + Intronic
1033705206 7:143879870-143879892 CAGCAGAGGCTGAGGGAGAAGGG - Intronic
1034032604 7:147784900-147784922 ATGCAGTGGCTGTGGGAAGAGGG + Intronic
1034538445 7:151740377-151740399 CTGCTGTGCCTGAAGGATGAAGG - Intronic
1034581190 7:152043924-152043946 AAGCAGTCCCTGTGGTAAGAAGG - Intronic
1034956745 7:155339681-155339703 CAGCAGTTCCCGTGGGAAGAAGG - Intergenic
1038315038 8:26477038-26477060 CACCAGTTAGTGAGGGAAGAAGG + Intronic
1038491905 8:27977449-27977471 CAGCAGAGGCTGAGGGAATGAGG - Intronic
1038947758 8:32379976-32379998 CAGCAGTGCAGTAAGGAAGAAGG - Intronic
1039625853 8:39051584-39051606 CAGCACTGCCTGTTGGAGGAAGG + Intronic
1040625911 8:49149842-49149864 CAGCAATGCTCAAGGGAAGAGGG + Intergenic
1041153503 8:54960523-54960545 CAGGGGTGCCTGAGGCCAGAGGG - Intergenic
1041406381 8:57504086-57504108 CAGCAGGGCCTGTGGGGAGCTGG - Intergenic
1042782688 8:72509635-72509657 CAGTATTGCCTCAGGAAAGAAGG + Intergenic
1045431861 8:102122525-102122547 CAGCAGGAACTGAGAGAAGAGGG + Intronic
1045526556 8:102945443-102945465 CAGCATGGCCTCAGTGAAGAGGG - Intronic
1045726327 8:105178037-105178059 GCGCAAAGCCTGAGGGAAGAGGG + Intronic
1047820875 8:128519055-128519077 GAGAAGTGCCTTAGAGAAGAAGG - Intergenic
1048178512 8:132174073-132174095 CAGCAGGGCCTGTGGCAAAAAGG + Intronic
1049234572 8:141506093-141506115 CTGCTGTGCCTGGGGGAAGCCGG - Intergenic
1049284283 8:141766223-141766245 CAGCAGTGCCTGGTGGGAGCAGG + Intergenic
1049702328 8:144020898-144020920 GAGAAGGTCCTGAGGGAAGAGGG - Intronic
1049703028 8:144023627-144023649 AAGAAGTTCCTCAGGGAAGAGGG - Intronic
1049703118 8:144023950-144023972 TAGAAGGTCCTGAGGGAAGAGGG - Intronic
1050105059 9:2156872-2156894 TACCAGCGGCTGAGGGAAGACGG - Intronic
1053034845 9:34816157-34816179 CAGAAGTTCCAGTGGGAAGATGG - Intergenic
1054814674 9:69463739-69463761 CTGCAGGGAGTGAGGGAAGAAGG + Intronic
1055524740 9:77120367-77120389 CAGAAGTATCTGGGGGAAGACGG - Intergenic
1057092265 9:92268980-92269002 CTGCAGTGCCCAAGAGAAGAAGG - Intronic
1057406164 9:94772679-94772701 CACCAGGGCCTGAGGGGAGGGGG + Intronic
1057700453 9:97360175-97360197 CAGTAGAGCCAAAGGGAAGAGGG + Intronic
1057702943 9:97376692-97376714 CAGCATTGCCCTAGGGGAGAGGG + Intronic
1058951770 9:109910670-109910692 CAGCAGGGCATGAGGGCAGAGGG + Intronic
1059792377 9:117654075-117654097 CAGAAGTTCCTGAGGGAACACGG - Intergenic
1060194831 9:121616891-121616913 CAGCAGTGCCTGGGGCAGCAGGG - Intronic
1060314713 9:122499055-122499077 GATCATTGCCTGAGGCAAGAGGG - Intergenic
1060519312 9:124285137-124285159 GTGCCGTGCCTGAGGGAATACGG - Intronic
1060831770 9:126722136-126722158 AAGAGGGGCCTGAGGGAAGAGGG - Intergenic
1061986114 9:134131295-134131317 CAGCACCACCTGGGGGAAGAGGG + Intergenic
1062074286 9:134575986-134576008 CAGCAGTGGGTGAGGGAATTGGG + Intergenic
1062118849 9:134823123-134823145 CAGCAGGGCCTGAGCTAGGACGG - Intronic
1062388787 9:136325959-136325981 CAGCAGCGCCTGGGGAAAGAGGG + Intergenic
1186844489 X:13517242-13517264 CAGGAGACCATGAGGGAAGAGGG + Intergenic
1187498215 X:19814488-19814510 CACCACTGCCGGAGGGAAGAGGG - Intronic
1187923178 X:24225715-24225737 CAGCAGTGTATGAGGGTGGAAGG + Intergenic
1188334764 X:28917147-28917169 CTTCATTGCCTGAGGGAAGATGG + Intronic
1188984949 X:36760888-36760910 CAGCAGAGCGTGAGTGAAGAGGG - Intergenic
1189200783 X:39194043-39194065 CAACAGTGGGTGAGTGAAGAAGG + Intergenic
1189308364 X:40004148-40004170 AAGCAGTCCCTGAGGGAGGAAGG + Intergenic
1193244599 X:79213160-79213182 GAGCACTGCATGGGGGAAGATGG - Intergenic
1194040857 X:88940789-88940811 GAGCATTGCCTGAGGCAGGATGG + Intergenic
1194821605 X:98514202-98514224 CAGCAGAGCCTGGGGACAGATGG - Intergenic
1194891573 X:99385134-99385156 CAGCAGTGCCTGGGAGCACAGGG + Intergenic
1195845172 X:109219795-109219817 CAGCAGGGACTGAGAGAAGAGGG + Intergenic
1197325991 X:125094142-125094164 CAGCAGGGCCTCAGGGACGCTGG - Intergenic
1198844813 X:140899663-140899685 AAGCATTGCCTGAGGCAGGATGG + Intergenic
1202298605 Y:23386555-23386577 CAGCATTGCCAGAGGGAAATGGG - Intergenic
1202572203 Y:26284044-26284066 CAGCATTGCCAGAGGGAAATGGG + Intergenic