ID: 1007761856

View in Genome Browser
Species Human (GRCh38)
Location 6:44137993-44138015
Sequence GTATCTCCCCACCTCCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007761856_1007761866 29 Left 1007761856 6:44137993-44138015 CCTGGCCGGAGGTGGGGAGATAC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1007761866 6:44138045-44138067 GTCCTTCTGGGGTAGACTAGAGG 0: 1
1: 1
2: 0
3: 4
4: 77
1007761856_1007761865 18 Left 1007761856 6:44137993-44138015 CCTGGCCGGAGGTGGGGAGATAC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1007761865 6:44138034-44138056 CCTGGGCTTTTGTCCTTCTGGGG 0: 1
1: 0
2: 3
3: 28
4: 273
1007761856_1007761863 17 Left 1007761856 6:44137993-44138015 CCTGGCCGGAGGTGGGGAGATAC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1007761863 6:44138033-44138055 CCCTGGGCTTTTGTCCTTCTGGG 0: 1
1: 0
2: 1
3: 28
4: 302
1007761856_1007761860 1 Left 1007761856 6:44137993-44138015 CCTGGCCGGAGGTGGGGAGATAC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1007761860 6:44138017-44138039 TTGCAGCTCATAGTGACCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 82
1007761856_1007761859 0 Left 1007761856 6:44137993-44138015 CCTGGCCGGAGGTGGGGAGATAC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1007761859 6:44138016-44138038 CTTGCAGCTCATAGTGACCCTGG No data
1007761856_1007761861 16 Left 1007761856 6:44137993-44138015 CCTGGCCGGAGGTGGGGAGATAC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1007761861 6:44138032-44138054 ACCCTGGGCTTTTGTCCTTCTGG 0: 1
1: 0
2: 4
3: 21
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007761856 Original CRISPR GTATCTCCCCACCTCCGGCC AGG (reversed) Intronic
900995854 1:6123292-6123314 TTATCCCCCCACCCCAGGCCTGG - Intronic
903044452 1:20554443-20554465 GACTCTGCCCACCGCCGGCCCGG - Exonic
904307242 1:29598094-29598116 GTTTCTCCCCATTTCCTGCCTGG - Intergenic
908261740 1:62344353-62344375 GTCCCTGCCCTCCTCCGGCCTGG - Intergenic
911086166 1:93979189-93979211 CTGGCTCCCCACCTCCGTCCTGG + Intergenic
914862352 1:151397265-151397287 AAATCTGCCCACCTCAGGCCGGG - Intergenic
915107121 1:153541544-153541566 GTTTCTCCCCAGCTCCATCCCGG - Intronic
921698909 1:218244956-218244978 TTACCTCCCTACCTCCTGCCAGG - Intergenic
1064796949 10:19022806-19022828 GCCTCTCCCCATCTCCTGCCTGG + Intergenic
1069638202 10:69938258-69938280 GCAGCTCCCCACCTCTGACCTGG - Intronic
1070537210 10:77388771-77388793 GTATCTCTCCATCTCAGCCCCGG + Intronic
1072180397 10:92975553-92975575 TGATCCCCCCACCTCCGTCCCGG - Intronic
1072620008 10:97073564-97073586 GTATCTCCCCAGCGCTGTCCTGG - Intronic
1073439985 10:103546804-103546826 GTCTCCCCCCACCTCTGACCTGG - Intronic
1073577710 10:104640048-104640070 CTCTCGCCCCACCTCTGGCCGGG + Intergenic
1075387588 10:122067917-122067939 GTATCTCCCCTCCTCCTGTGGGG + Intronic
1077240126 11:1506437-1506459 GTCTCTCCCCGACTCCAGCCGGG - Intergenic
1077628841 11:3797337-3797359 GTTTCTCCCCCCTTCCGGGCGGG - Intronic
1083120850 11:60510496-60510518 GTTGCCCCCCACCTCCGGACGGG - Intergenic
1083603449 11:63962609-63962631 GGGTCTCCCCACCCCAGGCCTGG - Intergenic
1083883142 11:65558111-65558133 GCATCTCCGCGCCTCCCGCCGGG - Exonic
1089640462 11:119844381-119844403 GTGTCTTCCCACCTCCTGCCTGG + Intergenic
1090648338 11:128784491-128784513 TTATCTCCCAACATCGGGCCTGG + Intronic
1091783922 12:3230934-3230956 CTATCTCCGCACCTCCAGGCAGG - Intronic
1091825437 12:3509021-3509043 GTGTCTCTTCACCTCTGGCCTGG + Intronic
1096714444 12:53482787-53482809 CTGGCTCACCACCTCCGGCCCGG - Exonic
1096839152 12:54370210-54370232 TCAACTCCCCACCTCCAGCCGGG - Exonic
1104837791 12:131802993-131803015 GTAATTCCTCACCACCGGCCAGG + Intergenic
1104997359 12:132666710-132666732 GTAGCTCCCCACCTCCTCCCTGG - Intronic
1106477216 13:30109013-30109035 TTAACTCCCCACCTCCCTCCAGG + Intergenic
1110922096 13:81102047-81102069 TGATCTCCCCACCTCCCTCCCGG + Intergenic
1112751705 13:102589953-102589975 ACATCTCCCCATCTCTGGCCTGG + Intergenic
1112880875 13:104104878-104104900 TTCTCTCCCCACCCCAGGCCTGG - Intergenic
1119779850 14:77270559-77270581 GGATCTCCCCACATCTGGGCGGG - Intronic
1120135912 14:80868059-80868081 GTCTCCCCCCACCCCCTGCCAGG - Intronic
1121901025 14:97693601-97693623 GTCCCTCCCCACCCCCCGCCAGG - Intergenic
1122776270 14:104118267-104118289 ATCTGTCCCCACCTCCAGCCAGG + Intergenic
1124004334 15:25784307-25784329 GTGTCTCTCCTCCTCCGCCCAGG - Intronic
1125376816 15:39039060-39039082 GTGTCTCCCCACCTCTGCACTGG + Intergenic
1130870614 15:87969020-87969042 CTATCCCCCCACCCCCTGCCAGG + Intronic
1132684104 16:1155022-1155044 CTGTCTCCCCACCTCCGACGGGG - Intronic
1132737635 16:1394795-1394817 CTCTCTCCTGACCTCCGGCCTGG + Intronic
1135718171 16:24791004-24791026 GAATCTCCCCACCTCAGAGCAGG - Exonic
1136298113 16:29315021-29315043 TTCTCCCCCCACCTCAGGCCAGG + Intergenic
1137781273 16:51099617-51099639 TTATCTCCCCATTTCCAGCCTGG + Intergenic
1138848495 16:60596911-60596933 ATATCTCCCCACCACCCGACAGG - Intergenic
1141723141 16:85767957-85767979 GTATCTCCCCATCTTCAGCAAGG - Intergenic
1142500117 17:327555-327577 GTGACTCCCCACCCCCAGCCGGG - Exonic
1142802059 17:2352443-2352465 CTTGCTCCCCACCTCCGGCCCGG - Intronic
1143409136 17:6697983-6698005 GGACCTCCCCACCTGAGGCCAGG - Intronic
1146568752 17:33935345-33935367 GCTTCTCCCCACCTCCAGGCTGG + Intronic
1157481332 18:48055871-48055893 GAATCTCCCCATCTCCACCCTGG + Intronic
1157765996 18:50298063-50298085 GACTCTCCTCACTTCCGGCCGGG - Intergenic
1160045632 18:75384738-75384760 ATCTCTCACCACCTCCGGCTTGG - Intergenic
1160724103 19:610082-610104 CTATCTCCCCGCCACAGGCCGGG + Intronic
1161376120 19:3939878-3939900 GTGTCTCCCCCACTCCGCCCAGG + Exonic
1161733639 19:5977625-5977647 GCATCTCCCCTTCCCCGGCCTGG - Intronic
1162501462 19:11056437-11056459 ACATCTCCCCATCTCCTGCCAGG - Intronic
1164601061 19:29563591-29563613 GTCACTCCCCACTTCAGGCCAGG + Intronic
1165718754 19:38063890-38063912 GGATCTCCCCGGCTCCAGCCAGG - Intronic
1165730198 19:38140292-38140314 GGATCTCCCCGCCTCAAGCCAGG + Intronic
1166177589 19:41085983-41086005 GTCTCTCCCCACCCCCTCCCTGG + Intergenic
1167044383 19:47041172-47041194 GTCTCTCCCCACCTCCAGTGGGG + Intronic
924962839 2:48845-48867 CTGTCTCCCCACCTCCCACCAGG - Intergenic
925179305 2:1806673-1806695 GGATCTGCCCACCGCCGCCCAGG + Intronic
928405148 2:31009027-31009049 TTATCTCCCCTCCTGCAGCCCGG - Intronic
928556214 2:32427857-32427879 GTATCTCCCTACCTTTTGCCAGG + Intronic
928558097 2:32447833-32447855 CTATCCCCCCACCTCCCTCCCGG + Intronic
929650767 2:43677880-43677902 TGATCTCCCCACCTCCCTCCAGG + Intronic
930149995 2:48049529-48049551 GCATCTCCCCACCTCTGGAATGG + Intergenic
931187624 2:59968799-59968821 GTTTCTCCACAACTCCAGCCAGG + Intergenic
932435470 2:71700563-71700585 AGATCTCCCCACCTCAGGGCAGG + Intergenic
935177586 2:100663391-100663413 GTCTCTGCCCAGCTCCTGCCAGG + Intergenic
937917603 2:127106635-127106657 CTGTCTCCCCACACCCGGCCGGG - Intronic
938359634 2:130677454-130677476 GCATCTGCTCACCTCAGGCCTGG + Intergenic
938934487 2:136116794-136116816 CCAGCTGCCCACCTCCGGCCGGG - Intronic
942096323 2:172538298-172538320 TTATCCCCCCACCTCCCTCCTGG - Intergenic
1169379191 20:5092200-5092222 TCATCTCCCCACCTCCAGCAAGG - Intronic
1173079680 20:39853647-39853669 GTATGTCCCCAACTCCTCCCTGG + Intergenic
1175648692 20:60697903-60697925 GTGACTCCCCACCTCCAGCCAGG + Intergenic
1176123243 20:63463620-63463642 GCTTCTCCCCACCTCCTCCCAGG + Intronic
1176242690 20:64082443-64082465 GTTTCTCCCCAGCCCCGGCCAGG - Intronic
1178672374 21:34603306-34603328 GCTTCTCCCTACCTGCGGCCTGG + Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179521960 21:41951489-41951511 GTCTCTCCTGACCTCCTGCCTGG - Intronic
1182071072 22:27464090-27464112 CTGTGTCCCCACCTCCTGCCGGG + Intergenic
1182519504 22:30877414-30877436 GAATGTCCCCACCTCATGCCTGG - Intronic
1183114410 22:35679087-35679109 GCATCTCTCTACCTCCAGCCAGG + Intergenic
1183263919 22:36814180-36814202 GTATCTGCCCACCTGCGGTGAGG + Intronic
1185330731 22:50251090-50251112 GCCTGTCCCCACCTTCGGCCGGG + Exonic
951450502 3:22832249-22832271 CTAGCTCCCCACCTCCTGACAGG - Intergenic
954535224 3:51354818-51354840 GTAGCCCCCCACCTCCACCCTGG - Intronic
956034418 3:65074995-65075017 CTAGCTCCCCACCTCCTGACAGG + Intergenic
963921654 3:150911378-150911400 GTCTCTCTCCACCTCTGGGCTGG + Intronic
964825319 3:160820058-160820080 GTCTCTTCCCACCTCCGATCTGG - Intronic
966610998 3:181867964-181867986 CAATCTTCCCACCTCGGGCCGGG + Intergenic
967995675 3:195164567-195164589 GTATCTGGCCACCTCTGGCCTGG - Intronic
968313147 3:197700739-197700761 GGCTCTCCCCACCTCCTTCCTGG + Exonic
968574449 4:1358606-1358628 GTATCTGCCCATCTCCCTCCTGG + Intronic
973107317 4:46356368-46356390 GTCTCTCCACACCCCTGGCCAGG + Intronic
974642937 4:64655125-64655147 CTATCTCCCCACCTGCTGACAGG + Intergenic
974664336 4:64938204-64938226 GTATGTCCCCACCTCCCACTAGG - Intergenic
982553973 4:156837807-156837829 GTAACTCCCAACCTCCTGTCTGG - Intronic
984593446 4:181641332-181641354 CTAGCTCCCCACCCCCGGCAGGG + Intergenic
984957900 4:185063866-185063888 GTATAACCTCACTTCCGGCCAGG - Intergenic
989677251 5:43986233-43986255 GAATCCCCCAACCTCCCGCCAGG + Intergenic
989745113 5:44819985-44820007 ATTTCTCCCAACCTCAGGCCTGG - Intronic
1002528522 5:179829258-179829280 GGGACTCCCCACCTCCTGCCTGG - Intronic
1002868977 6:1148497-1148519 GCATCTCCCCACCTCCCTCTTGG - Intergenic
1006516459 6:34548321-34548343 GGATCTGCCCACCTCCTGACTGG + Intronic
1007615622 6:43178379-43178401 GTATGCCCCCACCTCGGGCCTGG + Exonic
1007761856 6:44137993-44138015 GTATCTCCCCACCTCCGGCCAGG - Intronic
1015476984 6:133665545-133665567 GAATCCCCCCACCTCCCTCCCGG - Intergenic
1019126417 6:169843388-169843410 GGGTCTCCCCATCTCCTGCCTGG + Intergenic
1019645459 7:2126474-2126496 CTATCTTCCCCCCTCAGGCCTGG + Intronic
1022018588 7:26376753-26376775 GTGTAGCCCCTCCTCCGGCCGGG - Intergenic
1024439006 7:49393475-49393497 TTATCTCACCACCTCAGGGCTGG - Intergenic
1034621427 7:152460188-152460210 CTATCTGCCCACCTGGGGCCAGG + Intergenic
1037065229 8:14568226-14568248 CTTTCTCCCCACCCCCGGACAGG - Intronic
1041601033 8:59717469-59717491 GTAACTCTCCACCTCAGTCCAGG + Intergenic
1048376606 8:133828076-133828098 CTATCTCCCTTCCTCCAGCCTGG - Intergenic
1049212780 8:141394431-141394453 GTTTCTCCCCACCTCCACCCTGG + Intronic
1049719527 8:144109234-144109256 GCATCTCCGCAGCTCCGGCCAGG + Intronic
1052697625 9:31898552-31898574 CTACCTCCCCACCTCCTGACAGG + Intergenic
1053217970 9:36288610-36288632 GTCTCCTCCCACCTCCTGCCCGG - Intronic
1060427145 9:123515825-123515847 GGATCTACCCACCTCCTTCCTGG - Intronic
1060587680 9:124796607-124796629 TTCTCTCCCCACCTCCTCCCAGG - Intronic
1061624856 9:131835647-131835669 CGATCTCCCCAACTCCGGCCCGG + Intergenic
1062409056 9:136412977-136412999 GAATCTCCACACCTCCCGCTGGG - Intronic
1189308669 X:40005701-40005723 CTCCCTCCCCACCTCCGGCCCGG + Intergenic
1192988469 X:76426282-76426304 CTATCTCCCCACCTCTTGACAGG - Intergenic
1195707906 X:107751354-107751376 CTCTCTCCCCACCTCCTTCCCGG - Intronic
1196818701 X:119685989-119686011 AAATATCCCCACCTCAGGCCAGG + Intronic
1196857526 X:119998452-119998474 GTGTCACCCCTCCTCCAGCCTGG - Intergenic
1198525985 X:137501624-137501646 CTATCTCCCCAGCTCCGGGCTGG + Intergenic
1200149538 X:153944495-153944517 GGATCTCCCCACCTCTGCACGGG + Intronic