ID: 1007762541

View in Genome Browser
Species Human (GRCh38)
Location 6:44141474-44141496
Sequence CTGGACTCCTTGGAATCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007762541_1007762545 5 Left 1007762541 6:44141474-44141496 CCAGTGGATTCCAAGGAGTCCAG 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1007762545 6:44141502-44141524 CTTGAACTGTGTATTCTCTGAGG 0: 1
1: 0
2: 2
3: 13
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007762541 Original CRISPR CTGGACTCCTTGGAATCCAC TGG (reversed) Intronic
900041032 1:464553-464575 CTGGACTTCTGTGAATCCACAGG + Intergenic
900062462 1:699529-699551 CTGGACTTCCGTGAATCCACAGG + Intergenic
900917571 1:5649522-5649544 CCCGAATCCTTGGATTCCACGGG + Intergenic
901690496 1:10970015-10970037 CGTGGCTCCTTGGGATCCACAGG + Exonic
902219900 1:14958149-14958171 CTGGACTACTAGGGATCCACTGG - Intronic
902627548 1:17685293-17685315 CAGGCCACCTTGGAATCCATGGG - Intronic
902795814 1:18799831-18799853 CTGGATACATAGGAATCCACTGG + Intergenic
905190320 1:36228686-36228708 ATGGGCTCCCTGGAGTCCACCGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909392047 1:75130453-75130475 CGGGACACCCGGGAATCCACTGG - Exonic
911442216 1:97940979-97941001 CTGGAACCCTTGGCAACCACCGG + Intergenic
912687639 1:111779667-111779689 CTGGACTCCCTGAGAACCACAGG + Intronic
921328735 1:214014417-214014439 CACGATTCCTTGGAATCGACTGG - Intronic
924083105 1:240420088-240420110 CTGGGCTCATTAAAATCCACTGG - Intronic
1062928445 10:1335605-1335627 CTTGACTGCTTGCAAGCCACTGG + Intronic
1063182322 10:3615402-3615424 CTTAACTCCTTGTAGTCCACTGG + Intergenic
1065204190 10:23342591-23342613 CTGGACTCCTTGGCATTCCATGG - Intronic
1066979573 10:42399823-42399845 CTGGAAAGCTGGGAATCCACAGG - Intergenic
1068619319 10:59162398-59162420 CTGCCCTCCTTGTACTCCACAGG - Intergenic
1073512753 10:104052800-104052822 CTGACATCCCTGGAATCCACCGG - Intronic
1073589957 10:104747564-104747586 CTTGCCTCCTTGCAATCTACAGG - Intronic
1075550347 10:123388258-123388280 CTTGACTCCTGTGAACCCACAGG - Intergenic
1075734738 10:124657393-124657415 CAGGAGTCCATGGATTCCACAGG - Intronic
1076793017 10:132786631-132786653 CTCGAGTCCACGGAATCCACGGG + Intergenic
1076967304 11:100783-100805 CTGGACTTCCGTGAATCCACAGG + Intergenic
1078825035 11:14921566-14921588 CTTGACACTTTGGAATACACTGG - Intronic
1081787558 11:45757924-45757946 CTGGACTCCATGGTGTCCAGAGG - Intergenic
1083188186 11:61030315-61030337 CTGGAGTCCCAGGAATCCAGAGG + Intergenic
1084198773 11:67541537-67541559 CTGGACTCCTTGGACCACAGTGG + Intergenic
1085363142 11:75911207-75911229 CTGGCTTCCTGGGAATCCAGTGG + Intronic
1085417047 11:76326110-76326132 CCGGACACCTAGGAATCCTCAGG - Intergenic
1086616893 11:88831749-88831771 TTGGACTGCTTGGGATCCAAAGG + Intronic
1087026595 11:93655930-93655952 CTGGACATTTTGGAATCAACAGG - Intergenic
1087304567 11:96473159-96473181 ATGGACTGCTTGAAATCCAGAGG + Intronic
1091223935 11:133946602-133946624 CTGGACTCCTTGTAATTCTTGGG - Intronic
1094818553 12:34208227-34208249 CTGAAATCCTTGGAATACTCAGG + Intergenic
1095213989 12:39526981-39527003 CTGGACTTCTGTGCATCCACAGG + Intergenic
1095294689 12:40514618-40514640 CTGGGCTCCTGGAAATCCAGAGG - Intronic
1096487446 12:51993360-51993382 CCGCACTCCTTGGAACCCTCAGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1101395076 12:104339910-104339932 ATGTACACCTTGGAAGCCACTGG - Intronic
1108308820 13:49165772-49165794 ATGGACTGCTTGGAACCCAGAGG - Intronic
1110166602 13:72449892-72449914 CAGGGCTTCTTGGCATCCACAGG - Intergenic
1112294330 13:98173437-98173459 CTGGAGTCTTTGGAATCCTAGGG + Intronic
1115990299 14:39143512-39143534 TTGGAGTCCTGGGATTCCACAGG - Intergenic
1116268251 14:42725056-42725078 CTGGACTGCTAGGAATTCTCTGG + Intergenic
1122208269 14:100159280-100159302 CTGGGGTCCTCGGAATCCTCAGG + Intronic
1123162655 14:106294095-106294117 CTGCCCTCCCTGAAATCCACAGG - Intergenic
1124687254 15:31792916-31792938 CAGGACTGCTTAGAATCCCCAGG - Intronic
1127394162 15:58530191-58530213 CTGGACAACTTGGCCTCCACAGG + Intronic
1131830452 15:96351748-96351770 CTGAACACCTCCGAATCCACGGG - Intergenic
1132440869 15:101863051-101863073 CTGGACTTCTGTAAATCCACAGG - Intergenic
1138654937 16:58485713-58485735 CTGGTTTCCTCGGAAACCACTGG + Intronic
1142181202 16:88671516-88671538 CTGGTATCCATGGAATCTACTGG + Intergenic
1146124104 17:30218461-30218483 CTGGAGTCCTTGGAATGGAATGG - Intronic
1153180911 18:2432149-2432171 CTGAACTCCTTCAACTCCACAGG + Intergenic
1153434789 18:5057875-5057897 CTGGAGACCTTGAAATCCAGAGG + Intergenic
1154506587 18:15046165-15046187 CTTGACTTCTGGGCATCCACAGG + Intergenic
1155826033 18:30444253-30444275 CTGCACTTCATGGTATCCACTGG - Intergenic
1157234913 18:45955225-45955247 ATGGTCTCCTTTGAATTCACAGG + Exonic
1157585268 18:48797049-48797071 CAGGAGGCCTTGGAGTCCACAGG - Intronic
1158932723 18:62336745-62336767 CTGGGCTACCTGGAATCCAAGGG - Intronic
1160644107 19:170406-170428 CTGGACTTCCGTGAATCCACAGG + Intergenic
1163611885 19:18305957-18305979 CTGGAAGCCTTGGGATGCACCGG - Intergenic
1165227796 19:34366489-34366511 CTGGGCTCCTGGGAGTCCCCAGG + Intronic
1166294227 19:41881139-41881161 CAGGCCTCCTTGGACTCCCCTGG + Exonic
1166528263 19:43526705-43526727 CTGGACTACTTGGCCTCCAGTGG - Intronic
1168202608 19:54827361-54827383 CCTGACTTCTTGGAATCCACTGG - Intronic
925202794 2:1982453-1982475 ATGGAATCCATGGAATCCAATGG - Intronic
925720324 2:6820960-6820982 CTGGGCTCCCTGGAGTCCATTGG - Intergenic
926072847 2:9914298-9914320 CTGGTTTCCTGGGAATCCATGGG - Intronic
926112453 2:10192011-10192033 CTGGCCTCCATGAAATCCTCAGG - Intronic
926254829 2:11183243-11183265 CTGGGCTCCTTTGAAGCAACAGG - Exonic
929825429 2:45305997-45306019 CTGGGCTCCTGGGCCTCCACAGG + Intergenic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
933839881 2:86277770-86277792 CTGGACACCTAGCATTCCACAGG - Intronic
934750105 2:96788686-96788708 CTGGACTGACTGGAAGCCACAGG - Intronic
936269323 2:111036673-111036695 CTGGACTCCCTCGACTCCCCAGG - Intronic
937942380 2:127296164-127296186 TTGGACTCCCAGGATTCCACAGG + Intergenic
942073846 2:172339015-172339037 CTGTAGTCCATGGAGTCCACTGG - Intergenic
942378049 2:175357035-175357057 CAGGAGTCCTTGGCATCCTCTGG + Intergenic
943245686 2:185448034-185448056 CTGGACTACTGGAAATACACTGG + Intergenic
943266422 2:185738528-185738550 CAGGGCTCCTTGGAAGCCAGGGG + Intergenic
943478193 2:188385241-188385263 CTTGACTTCTGGGCATCCACAGG + Intronic
943610032 2:190021526-190021548 CTGCACTCCTTGCAATCAAATGG - Intronic
946360510 2:219216742-219216764 CTGGACTCCCTCGAGGCCACAGG + Exonic
946989223 2:225309063-225309085 TTGGACACCCTGGCATCCACAGG + Intergenic
1171034016 20:21702392-21702414 CTGGAGTCCTTGAAATGCATGGG + Intergenic
1171242923 20:23586160-23586182 GTGGCCTCCTGGGACTCCACAGG - Intergenic
1172766825 20:37355516-37355538 CTGGACTCTCTGTTATCCACCGG + Intronic
1175694752 20:61093420-61093442 CTGAACACCTTGTAATACACAGG - Intergenic
1175826799 20:61940931-61940953 CCGGACTCCATGGAATGCCCGGG + Intergenic
1176791277 21:13322942-13322964 CTTGACTTCTGGGCATCCACAGG - Intergenic
1177990516 21:28030429-28030451 CTTGACTTCTGGGCATCCACAGG + Intergenic
1178921831 21:36743824-36743846 CTTGACGGGTTGGAATCCACGGG + Intronic
1183426745 22:37743967-37743989 CTGGACTACTAGGAATTCCCAGG - Intronic
1184507941 22:44915566-44915588 CAGGACTCCCGGGAATGCACTGG + Intronic
1184835019 22:47015964-47015986 CTGGTCTCCTTGGCGTCCACTGG + Intronic
1185127358 22:49018541-49018563 CCGGAATCCTTGGTGTCCACAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950162615 3:10771777-10771799 CTGTACTCATTGGAATCTTCTGG - Intergenic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
952990411 3:38826585-38826607 CTGGACTCCTTGGGGTCTGCAGG + Intergenic
954134302 3:48575088-48575110 CTGGACTCCCTGGAACCCCTGGG - Exonic
955045716 3:55357918-55357940 CTGGCCTTATTGGAATCCATGGG + Intergenic
957864296 3:86002260-86002282 GAGGAATCCTTTGAATCCACGGG + Intronic
959422051 3:106140870-106140892 TCTGACTTCTTGGAATCCACTGG - Intergenic
960162803 3:114368675-114368697 CTGGAGGCCTTGGACTCTACTGG - Intronic
962178864 3:133184014-133184036 CTGTACTGCCTGGCATCCACTGG - Intronic
962819905 3:139038489-139038511 CTGAACTCCTTGGTAGCCAAGGG - Intronic
964735259 3:159910939-159910961 ATGAATTCCTTGGAATTCACAGG + Intergenic
965371111 3:167863609-167863631 CTGGTCTCCCTGCGATCCACAGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
968531510 4:1094324-1094346 CTGGCCTCCTTGGATGTCACCGG - Intronic
975827777 4:78337833-78337855 GTGGACTCCTCGGAAATCACTGG + Intronic
982653571 4:158118385-158118407 CTGAACATCTTGCAATCCACAGG + Intergenic
983753142 4:171301378-171301400 TTGGCCTCCTTGGACTCCAATGG - Intergenic
985548522 5:521826-521848 CTGGACTTCTCAGATTCCACTGG - Intronic
988807933 5:34757654-34757676 CTGGAATCCTTAGTATCCATAGG + Intronic
994900433 5:105762757-105762779 CTTGACTTCTGGGTATCCACAGG + Intergenic
1002732814 5:181354375-181354397 CTGGACTTCCGTGAATCCACAGG - Intergenic
1002751724 6:119731-119753 CTGGACTTCTGTGAATCCACAGG + Intergenic
1006631821 6:35435686-35435708 CGGCACTCCTGGAAATCCACCGG - Intergenic
1007107900 6:39295896-39295918 CTTGACTCCTTGGAAGCCAGAGG - Intergenic
1007762541 6:44141474-44141496 CTGGACTCCTTGGAATCCACTGG - Intronic
1013360840 6:109392603-109392625 CTAGACTCCTTTGCAGCCACGGG - Intronic
1015100718 6:129476490-129476512 CTGGACTCAATGGTAACCACGGG - Intronic
1016590541 6:145738892-145738914 CTGGAATTATTGGAATCGACTGG - Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018882547 6:167899346-167899368 CTGGTTTCCTTGGATGCCACAGG - Intronic
1019237069 6:170626693-170626715 CTGGACTTCTGTGAATCCACAGG - Intergenic
1019894745 7:3975082-3975104 CTGGGCTCTTTGGAACCCCCAGG - Intronic
1021628662 7:22622083-22622105 CTGGACTCCTTCAACTCTACTGG - Intronic
1022096837 7:27146565-27146587 GTGGAGTCCTTGGAAACCAGAGG + Intronic
1024853864 7:53754241-53754263 TTGGACTCCTTGGATTTTACAGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026450413 7:70524403-70524425 TTGGATTCCTTAGAATCCAGGGG + Intronic
1030701521 7:112646672-112646694 CTGGATTCCTTAGAATTAACAGG + Intergenic
1032125198 7:129188626-129188648 CTGGGCTCTCTGGAATGCACGGG - Intergenic
1035510701 8:179917-179939 CTGGACTTCCGTGAATCCACAGG + Intergenic
1037579976 8:20239323-20239345 CTGGAGTCCCTGGAATTGACTGG - Intergenic
1041254845 8:55971265-55971287 CTGGAAACCTTGGAATCCCATGG - Intronic
1041635138 8:60134338-60134360 CTGGACTCACTGGAAGGCACTGG - Intergenic
1041738902 8:61138650-61138672 CTGGACTCCTGGGGACCCACTGG - Intronic
1043150078 8:76704587-76704609 CTGGACTCCCTGGCATCTGCTGG + Exonic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1052470296 9:28885323-28885345 CTGGACTCCCTGGAAGCAGCAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052898615 9:33771025-33771047 CTGGACACCCTGCAATGCACAGG + Intronic
1053295155 9:36907463-36907485 CAGGGCACCTTGGCATCCACAGG - Intronic
1055337803 9:75250887-75250909 CTGGACTCCTTAGATTCCTCAGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057511730 9:95685675-95685697 ATGAAATCCTTGGAATCCAAAGG + Intergenic
1059410105 9:114126615-114126637 CTGGAATCCTTGGCCTCCCCAGG + Intergenic
1059943719 9:119384408-119384430 CTGAATCCCTTGGAATCCAATGG + Intergenic
1059996738 9:119917886-119917908 ATGGACTGCTTGGAATTCCCAGG + Intergenic
1060152550 9:121298212-121298234 CTGGACCCCTGGTAATTCACTGG + Intronic
1060680562 9:125559720-125559742 ATGGGCTCATTGGAATCCAGCGG + Exonic
1061038628 9:128127368-128127390 CGGGACTCCTGGGAACCCGCAGG - Intronic
1062757221 9:138306699-138306721 CTGGACTTCCGTGAATCCACAGG - Intergenic
1189952425 X:46246314-46246336 CTGAACTCCTTAGAATTCAATGG - Intergenic
1193725064 X:85028522-85028544 CTGGACTCCTTGTAACTCAGAGG - Intronic
1193798470 X:85906343-85906365 TTGGAGACCTTGGAATCCAGTGG - Intronic
1195330236 X:103791383-103791405 CTCAGCTCCTTGGAAACCACAGG - Exonic
1199919847 X:152387926-152387948 CTGCACTTCTAGGAATCTACTGG + Intronic
1200826803 Y:7653681-7653703 CTGGACTCTGTGAAATCCTCAGG - Intergenic