ID: 1007766933

View in Genome Browser
Species Human (GRCh38)
Location 6:44166157-44166179
Sequence TTGGGGCAGTGGCAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007766920_1007766933 28 Left 1007766920 6:44166106-44166128 CCTGAGGAAATCCCAAGGAGGTA 0: 1
1: 0
2: 0
3: 13
4: 147
Right 1007766933 6:44166157-44166179 TTGGGGCAGTGGCAAGAGGAAGG No data
1007766922_1007766933 17 Left 1007766922 6:44166117-44166139 CCCAAGGAGGTACTCGTGTGGAA 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1007766933 6:44166157-44166179 TTGGGGCAGTGGCAAGAGGAAGG No data
1007766923_1007766933 16 Left 1007766923 6:44166118-44166140 CCAAGGAGGTACTCGTGTGGAAC 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1007766933 6:44166157-44166179 TTGGGGCAGTGGCAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007766933 Original CRISPR TTGGGGCAGTGGCAAGAGGA AGG Intronic
No off target data available for this crispr