ID: 1007767832

View in Genome Browser
Species Human (GRCh38)
Location 6:44171394-44171416
Sequence CTGGGTCCCCAATATAATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 80}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007767820_1007767832 15 Left 1007767820 6:44171356-44171378 CCTAGCTCCAGGGACCCTGCTGG 0: 1
1: 0
2: 6
3: 55
4: 451
Right 1007767832 6:44171394-44171416 CTGGGTCCCCAATATAATGTGGG 0: 1
1: 0
2: 1
3: 3
4: 80
1007767826_1007767832 0 Left 1007767826 6:44171371-44171393 CCTGCTGGGGCACATACTGAGCC 0: 1
1: 0
2: 1
3: 17
4: 277
Right 1007767832 6:44171394-44171416 CTGGGTCCCCAATATAATGTGGG 0: 1
1: 0
2: 1
3: 3
4: 80
1007767817_1007767832 26 Left 1007767817 6:44171345-44171367 CCACTTCAATGCCTAGCTCCAGG 0: 1
1: 0
2: 4
3: 14
4: 181
Right 1007767832 6:44171394-44171416 CTGGGTCCCCAATATAATGTGGG 0: 1
1: 0
2: 1
3: 3
4: 80
1007767816_1007767832 27 Left 1007767816 6:44171344-44171366 CCCACTTCAATGCCTAGCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 175
Right 1007767832 6:44171394-44171416 CTGGGTCCCCAATATAATGTGGG 0: 1
1: 0
2: 1
3: 3
4: 80
1007767825_1007767832 1 Left 1007767825 6:44171370-44171392 CCCTGCTGGGGCACATACTGAGC 0: 1
1: 0
2: 0
3: 17
4: 227
Right 1007767832 6:44171394-44171416 CTGGGTCCCCAATATAATGTGGG 0: 1
1: 0
2: 1
3: 3
4: 80
1007767824_1007767832 8 Left 1007767824 6:44171363-44171385 CCAGGGACCCTGCTGGGGCACAT 0: 1
1: 0
2: 1
3: 24
4: 269
Right 1007767832 6:44171394-44171416 CTGGGTCCCCAATATAATGTGGG 0: 1
1: 0
2: 1
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007767832 Original CRISPR CTGGGTCCCCAATATAATGT GGG Intronic
900207682 1:1438586-1438608 CTGGGTCCCCAGGAGAGTGTGGG - Intronic
917645367 1:177024097-177024119 GGGGGACCCCAATATAATGAGGG - Intronic
1063387291 10:5623964-5623986 TTGGGTCCCTAAAATATTGTGGG - Intergenic
1078519410 11:12051228-12051250 CTGGGTTCCCACCATGATGTGGG - Intergenic
1082147326 11:48685900-48685922 CTGGGTCCCTAACAAAATGAAGG + Intergenic
1084361800 11:68673541-68673563 CTGGGTCCCCCACAACATGTGGG + Intergenic
1087437555 11:98141450-98141472 CTGGTTCAGCAATATAATGGGGG - Intergenic
1095370151 12:41457610-41457632 CTTGGTCCCCTAGAAAATGTAGG - Intronic
1096175783 12:49517589-49517611 CTGGGTCCCTAATGTCATCTGGG - Intronic
1099671935 12:85705674-85705696 CTGGGTCCCCCATGACATGTGGG - Intergenic
1100354629 12:93817837-93817859 CTGGGTCCCCAAGAGAAGGCAGG - Intronic
1101687491 12:107039688-107039710 CTGGAACCCTAATGTAATGTTGG + Intronic
1102258912 12:111431368-111431390 CTGGGTACCCCATGTAATCTAGG + Intronic
1104012691 12:124943234-124943256 CTGGGTCCCCAAAACATGGTAGG - Intergenic
1105769567 13:23595623-23595645 CAGGGACACCAATAAAATGTAGG - Intronic
1108511572 13:51160893-51160915 CAGGATCTCCAATACAATGTTGG - Intergenic
1112979273 13:105361574-105361596 CATGGTCCCAGATATAATGTTGG - Intergenic
1113306124 13:109080624-109080646 CTTTGTCCACAATAGAATGTAGG + Intronic
1121060785 14:90907669-90907691 CTGGGAACCCAAGAAAATGTTGG + Intronic
1126702293 15:51379253-51379275 CTGGGTCCCCAAGGAAATCTGGG - Intronic
1127356623 15:58207061-58207083 CTGGGTCCCTTCCATAATGTGGG - Intronic
1127560860 15:60134721-60134743 CTGGGGCCCTAACATAAGGTTGG + Intergenic
1132271550 15:100530779-100530801 CTGGTTCCCCAATATTCTTTTGG - Intronic
1144071907 17:11681646-11681668 CTGGGTCTCCTCTATATTGTTGG + Intronic
1147368769 17:39976965-39976987 CTGGGTCCCACATATATTGGGGG - Exonic
1147893427 17:43733704-43733726 CTGGGGACCCCATATTATGTGGG + Intergenic
1157454262 18:47812134-47812156 CTGGGTCCCTCACATAATATGGG - Exonic
1159487813 18:69088156-69088178 CATGGTACCCTATATAATGTAGG - Intergenic
1162259819 19:9523514-9523536 CTGGGACCTCAAGATAATGGTGG - Intergenic
1166346095 19:42166881-42166903 CTGCTTGCCCAATATAATGGTGG - Intronic
1167411086 19:49344209-49344231 CTGGGTCCCCAAAACAGTCTTGG + Intronic
927242955 2:20934751-20934773 CTGGGTCCCCAAGAAGATGGAGG - Intergenic
929940112 2:46327223-46327245 CTGTGTGCCCAATATTGTGTTGG + Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
932342390 2:70974543-70974565 CTGGGTGCCCACTATATTGTAGG - Intronic
946114237 2:217447505-217447527 CTGGGTGGCCAATACAATGAAGG - Intronic
947144056 2:227048116-227048138 CTGGCTCCCAACCATAATGTAGG - Intronic
1169636511 20:7698173-7698195 ATGTGTCCCCTATAAAATGTAGG + Intergenic
1171017239 20:21553100-21553122 CTGGGTCCCCAGCATAATGCTGG - Intergenic
1173745953 20:45437192-45437214 CTTGGGCCTCAAGATAATGTCGG + Intergenic
1174935103 20:54858812-54858834 CTGTGTCCCTAATATATTTTTGG - Intergenic
1176158207 20:63634014-63634036 CTGGGTGTCCAATATAATACAGG - Intergenic
1183114360 22:35678739-35678761 CTGGGTTCCCAATCTTATCTTGG + Intergenic
1183541091 22:38429797-38429819 CTGGGTTCCCAATAACATTTTGG + Intronic
951006596 3:17623006-17623028 CTGGGCCCCCAATAAAATTCTGG + Intronic
959121031 3:102232330-102232352 CTGGGTGCCCAGTAGAATGGTGG + Intronic
962826092 3:139101966-139101988 CTGTGTCCTCAAGATAATCTTGG - Intronic
964740169 3:159956729-159956751 CTGTGTCCTCACTATAATTTTGG - Intergenic
965994215 3:174859726-174859748 CTTAATCCCCAGTATAATGTTGG + Intronic
969921993 4:10549039-10549061 CTGTGTCTTCATTATAATGTAGG + Intronic
970778513 4:19706796-19706818 ATGGGTCACCAACATAATGATGG - Intergenic
972155273 4:36153456-36153478 CTGTGGCCCCAATTTTATGTTGG - Intronic
974517785 4:62939213-62939235 CTAGGTGCCCATTAAAATGTTGG - Intergenic
975037777 4:69705625-69705647 TTGGCTCCCCTCTATAATGTTGG - Intergenic
978441590 4:108739562-108739584 CTGGGTCTCCAATATGATCCTGG + Intergenic
982689155 4:158528834-158528856 CTGGGTGCCCCAGATAATGTAGG + Intronic
986207025 5:5634493-5634515 CTGGGTCCACCTTATAATTTTGG + Intergenic
992476791 5:77110545-77110567 CTGCATCCCCAATTTCATGTTGG + Intergenic
993211238 5:84954486-84954508 CTGGATCCCTCATATAATGCTGG + Intergenic
999452862 5:151691476-151691498 CAGGGACCCCAATATACTGATGG - Intergenic
1001092240 5:168750024-168750046 CTGAGTCCCCCATATCAAGTGGG + Intronic
1007767832 6:44171394-44171416 CTGGGTCCCCAATATAATGTGGG + Intronic
1010831296 6:80533551-80533573 CTAGCTCCTAAATATAATGTAGG + Intergenic
1014458571 6:121667459-121667481 CTGGGCCCCCAAGATATGGTAGG - Intergenic
1016384719 6:143519266-143519288 CTGGGATCCCAATCTAATCTGGG + Intergenic
1017830687 6:158126318-158126340 ATGCCTCCCCAAAATAATGTGGG + Intronic
1020523028 7:9218746-9218768 CTGGTTCCCCACTAGACTGTAGG - Intergenic
1023171500 7:37394125-37394147 CAGGGACACTAATATAATGTTGG + Intronic
1026514767 7:71059318-71059340 CTGGGTCCCCAAAAGTGTGTGGG - Intergenic
1030892539 7:115016729-115016751 CTGGTTCCCAACTATTATGTGGG - Exonic
1031445571 7:121849426-121849448 CTGGGTCCCTCCTATGATGTGGG + Intergenic
1034995081 7:155571957-155571979 CTCGGTCCCTAAAATAATGCTGG + Intergenic
1036407300 8:8466618-8466640 CTGTGTCCCCAGTAAAATGAGGG - Intergenic
1041793678 8:61723694-61723716 CTGTGTCCCCAGTATAAACTAGG + Intergenic
1042421663 8:68597634-68597656 CTTGGTCGCCAAAATAATGAGGG - Intronic
1042932690 8:74029400-74029422 CTGGGTCCCCCATGACATGTGGG - Intergenic
1046162814 8:110389429-110389451 CTGGGTACACAACATAATGAAGG - Intergenic
1049409736 8:142467204-142467226 TTGGGTTCCCAAGATAACGTGGG - Intronic
1050327387 9:4510381-4510403 CTGTCTCCCCACTATAATTTAGG + Intronic
1053150308 9:35739002-35739024 CTGGGTCCCCAATATCATGGGGG + Exonic
1056021603 9:82443738-82443760 CTGGGTTCCCATAATAATCTAGG - Intergenic
1061209038 9:129180116-129180138 CTGTATCACCAATAAAATGTAGG - Intergenic
1194827098 X:98577263-98577285 CTGGATCCCCCATCTAATGATGG - Intergenic
1201339629 Y:12919751-12919773 CATGGTCCCCAATAAAATTTAGG - Intronic
1202090135 Y:21180274-21180296 CTGGGATCCCAACAAAATGTTGG - Intergenic