ID: 1007768676

View in Genome Browser
Species Human (GRCh38)
Location 6:44176723-44176745
Sequence CTCCTCTCTGTGCCTTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 288}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007768666_1007768676 10 Left 1007768666 6:44176690-44176712 CCCTAGGCCCTGGTCCTTCATCT 0: 1
1: 0
2: 0
3: 17
4: 243
Right 1007768676 6:44176723-44176745 CTCCTCTCTGTGCCTTGGATGGG 0: 1
1: 0
2: 2
3: 32
4: 288
1007768668_1007768676 3 Left 1007768668 6:44176697-44176719 CCCTGGTCCTTCATCTCCCTGCT 0: 1
1: 0
2: 3
3: 30
4: 489
Right 1007768676 6:44176723-44176745 CTCCTCTCTGTGCCTTGGATGGG 0: 1
1: 0
2: 2
3: 32
4: 288
1007768670_1007768676 -4 Left 1007768670 6:44176704-44176726 CCTTCATCTCCCTGCTCCGCTCC 0: 1
1: 0
2: 3
3: 74
4: 808
Right 1007768676 6:44176723-44176745 CTCCTCTCTGTGCCTTGGATGGG 0: 1
1: 0
2: 2
3: 32
4: 288
1007768667_1007768676 9 Left 1007768667 6:44176691-44176713 CCTAGGCCCTGGTCCTTCATCTC 0: 1
1: 0
2: 1
3: 28
4: 317
Right 1007768676 6:44176723-44176745 CTCCTCTCTGTGCCTTGGATGGG 0: 1
1: 0
2: 2
3: 32
4: 288
1007768664_1007768676 16 Left 1007768664 6:44176684-44176706 CCACCACCCTAGGCCCTGGTCCT 0: 1
1: 0
2: 8
3: 46
4: 414
Right 1007768676 6:44176723-44176745 CTCCTCTCTGTGCCTTGGATGGG 0: 1
1: 0
2: 2
3: 32
4: 288
1007768669_1007768676 2 Left 1007768669 6:44176698-44176720 CCTGGTCCTTCATCTCCCTGCTC 0: 1
1: 0
2: 2
3: 40
4: 484
Right 1007768676 6:44176723-44176745 CTCCTCTCTGTGCCTTGGATGGG 0: 1
1: 0
2: 2
3: 32
4: 288
1007768665_1007768676 13 Left 1007768665 6:44176687-44176709 CCACCCTAGGCCCTGGTCCTTCA 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1007768676 6:44176723-44176745 CTCCTCTCTGTGCCTTGGATGGG 0: 1
1: 0
2: 2
3: 32
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007768676 Original CRISPR CTCCTCTCTGTGCCTTGGAT GGG Intronic
900226895 1:1537134-1537156 CTCCTCCCTGTTCCTGGGCTCGG - Intronic
900474991 1:2871964-2871986 CTTCTCTGTGTGGCTTGGAGGGG + Intergenic
900649244 1:3722947-3722969 CACCTCTCTGTGCCTGGCACAGG + Intronic
900649290 1:3723140-3723162 CACCTCTCTGTGCCTGGCACGGG + Intronic
900797113 1:4714816-4714838 CTCTTCCCTTTGCCTTGGCTGGG - Intronic
901567176 1:10127080-10127102 CTCCTGTCTAGGACTTGGATAGG - Intronic
902058725 1:13623784-13623806 CACCTCTCAGTGCCTTCCATTGG - Intergenic
902188556 1:14743885-14743907 ATCCCCTCTGTTCCATGGATGGG - Intronic
902482017 1:16717065-16717087 CTCCTCACTCTGCCCTGAATGGG + Intergenic
905620619 1:39442963-39442985 CTCTTCTCTCTGACTTAGATAGG - Intronic
907678475 1:56540857-56540879 CTCTTCTCTGTGTCCTGGAAGGG - Intronic
907730246 1:57059072-57059094 CTCCTCACTGAGCCAGGGATTGG - Intronic
907738654 1:57141316-57141338 CTCCTGCCTCTGCCTTGCATTGG - Intronic
908232312 1:62117891-62117913 CTCCTCTCTGGGTTATGGATAGG + Intronic
911895872 1:103434222-103434244 CTCCTCTTTGTGTCTTAGTTTGG - Intergenic
912582441 1:110732966-110732988 CTCCTCTTTGTGCTATGGCTTGG - Intergenic
913088658 1:115461052-115461074 CCCCTCTCTGAGCCAAGGATGGG - Intergenic
914797760 1:150935547-150935569 TTTCTCTCTGTGCTTTGGATTGG + Intronic
914918726 1:151833557-151833579 CTCCACTCTGTGCCTGCAATTGG - Intergenic
915139451 1:153758208-153758230 TTCCTCTCTGTGCCTAGGGTGGG + Intronic
915753132 1:158230979-158231001 AGCCACTCTGTGCCTTTGATTGG - Intergenic
916901068 1:169224295-169224317 CTCCTCTCTGTGCATAAGATCGG + Intronic
918808562 1:189084043-189084065 CTCATCTTTGTGCCTTGTTTAGG - Intergenic
919280716 1:195485490-195485512 CTCCCCTCTGTGCCAGGGCTGGG - Intergenic
919318938 1:196009235-196009257 TTCCTCTATGTGCCTTATATTGG - Intergenic
919764407 1:201116925-201116947 CTCCTTTCTGTCTCTTGGAGAGG - Intronic
920691053 1:208146550-208146572 CTCATGTCTCTGTCTTGGATAGG + Intronic
921830528 1:219723408-219723430 CTCATTTCTGTGTCCTGGATTGG - Intronic
922501327 1:226098917-226098939 CACCTCACTGTGGCTGGGATAGG - Intergenic
923028885 1:230230920-230230942 CCCCTCTCTGGGCCTTGTAGAGG + Intronic
923252871 1:232193340-232193362 CCCCTCTATGTTCCTTGGCTGGG + Intergenic
923470120 1:234282752-234282774 CTCCTCTCTGGGCCTGGCATTGG + Intronic
923839185 1:237649526-237649548 CTCCTCTCTTTGCCTAGCAAAGG + Intronic
924311474 1:242747957-242747979 CTTTCCTCTGTGCCTTGAATAGG + Intergenic
1064008373 10:11715569-11715591 CTCCTTTCTCTGCCTGGGTTTGG + Intergenic
1064664731 10:17639117-17639139 TTCCTCTCAGTGTGTTGGATGGG - Intergenic
1068486602 10:57666906-57666928 CTGCCCTCTGTGCCATGGATTGG - Intergenic
1068631484 10:59303114-59303136 CTTCTCTCTGTTCCTTGAACAGG + Intronic
1069197489 10:65570939-65570961 CTCCCCTCTGTGCCCGGGACGGG + Intergenic
1069315191 10:67090208-67090230 CTTCTTTCTATGCCTTGTATTGG + Intronic
1070743732 10:78919990-78920012 CCTCTCCCAGTGCCTTGGATCGG - Intergenic
1073571569 10:104584792-104584814 CTGCTCTGTGTCCCTTAGATGGG - Intergenic
1074039727 10:109776295-109776317 CTGCTCTGTGGGGCTTGGATGGG + Intergenic
1074331764 10:112519275-112519297 CTCCTCTCTGAGCCATAGGTAGG + Intronic
1075025540 10:118980603-118980625 ATCCTCTCACAGCCTTGGATCGG + Intergenic
1075066247 10:119290920-119290942 CTCCTGTCTCTGACTTGGACAGG - Intronic
1075072329 10:119327375-119327397 CTCCCCTCTGTGCCCTGGGGTGG + Intronic
1075579225 10:123604157-123604179 TTCCTCTCTGAGCCATGCATTGG - Intergenic
1075925085 10:126245171-126245193 CTCCAGTCTGTGCTTTGGAAAGG + Intronic
1076335147 10:129701980-129702002 CACCTTTCTGTGCCCTGGTTTGG + Intronic
1076672067 10:132127704-132127726 CTCTACTCCTTGCCTTGGATGGG + Intronic
1076814171 10:132906513-132906535 CTCTTCTCAGTGCCCAGGATGGG - Intronic
1076814248 10:132906849-132906871 CTCTTCTCAGTGCCCAGGATGGG - Intronic
1076829991 10:132989221-132989243 CCCCTCTCTGTGCCCTGGTGTGG + Intergenic
1077069889 11:664344-664366 CTCCTCTCAGTGCCATGGCTTGG - Intronic
1077661977 11:4077714-4077736 TTTCTCTCTGTGCTTTGGTTTGG + Intronic
1078453480 11:11457454-11457476 CTCATATCTGCTCCTTGGATTGG + Intronic
1082575424 11:54797840-54797862 CTCCTTTCTTTGACTTGGAAAGG - Intergenic
1082793767 11:57365442-57365464 CTCCTCTCAGCGCCTTCCATTGG + Intronic
1083020675 11:59504005-59504027 CTCATCTCTGCCTCTTGGATGGG + Exonic
1084556683 11:69879898-69879920 CTCATCTCTGTGCCCAGGAAGGG - Intergenic
1085837706 11:79974357-79974379 CTCCTCCCAGTGCCTTCCATTGG + Intergenic
1087432304 11:98069653-98069675 CTCCCCTATGTGCCTGGGCTAGG - Intergenic
1088210399 11:107448411-107448433 TTCCTTTCTATGCCTTGGGTTGG - Intronic
1089633388 11:119797124-119797146 ATCCTCCCTGTGCCTCGGAAGGG + Intergenic
1090613127 11:128489538-128489560 GTCCTCTCTGAGGCTTGGATAGG - Intronic
1091383318 12:76935-76957 CTTGTCTCTCTGCCTGGGATGGG - Intronic
1094114976 12:26901366-26901388 CTCCTCTCTGTACCTCTGGTAGG - Intergenic
1094293431 12:28877334-28877356 CTACTCTCTGTGCCCTTGCTGGG + Intergenic
1095394408 12:41745592-41745614 CTTCACTCTGTGCCTTTGAGAGG - Intergenic
1096570322 12:52519349-52519371 GTGCTTTCTGTGCCCTGGATAGG - Intronic
1096991739 12:55810033-55810055 CTTTTCTCTGTGGGTTGGATAGG - Intronic
1100704665 12:97186962-97186984 CTCCTCTCAGTGCCAGGGCTGGG - Intergenic
1102467180 12:113136614-113136636 AACCTCTCTGTGCTTTGGTTTGG + Intergenic
1102616755 12:114161391-114161413 CTCATCTCTGTTCCTAGGATAGG - Intergenic
1102626435 12:114239160-114239182 TACCGCTCTGTGCATTGGATGGG - Intergenic
1102772229 12:115488049-115488071 TTTCTCTCTGTGCCTAGGCTGGG - Intergenic
1102949235 12:117018359-117018381 CTCCTCTTTGTCCCTGGAATCGG + Intronic
1104505374 12:129327167-129327189 CTCCTCTCAGTGCCTTACATTGG + Intronic
1104962209 12:132493648-132493670 CCCTTTTCTGTGCCCTGGATGGG + Intronic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1106278185 13:28235472-28235494 ATCATCTCTGTGCCTTTGCTTGG + Intronic
1107411450 13:40162262-40162284 TTCCTCTCTGTTCCTTAGAAGGG - Intergenic
1107594244 13:41945713-41945735 CTTCTTTCTGTTCCTTAGATTGG - Intronic
1111923015 13:94432296-94432318 CTCAGCTCTGTGATTTGGATGGG - Intergenic
1113662632 13:112117762-112117784 CTCCTCCCTGGGCCTTGGGCAGG - Intergenic
1114494972 14:23126250-23126272 CTCCTCTCTGGGCCTTGGCTTGG - Exonic
1114550187 14:23528295-23528317 CTCCCCACTTTCCCTTGGATTGG + Intronic
1115787001 14:36837454-36837476 TTCCTCTCTGTGCTCTGTATTGG - Intronic
1118362710 14:65069604-65069626 TTCATCTCTGTGCCCTTGATAGG - Intronic
1119688049 14:76648643-76648665 AACCTCTCTGTGTCTTGGACTGG + Intergenic
1120538580 14:85727510-85727532 CTCCTGTCTGTACCTTCCATTGG + Intergenic
1121002802 14:90464363-90464385 CTCCTCTGTGCTCCTGGGATTGG + Intergenic
1122347079 14:101067371-101067393 CTCCTCTCCATGCCTAGCATGGG + Intergenic
1122353454 14:101110518-101110540 CTCCTCTCTGGCCCTGGGTTTGG - Intergenic
1122672533 14:103383698-103383720 CTCCTCTCTGAGGGTTAGATGGG + Intergenic
1122870903 14:104638434-104638456 CTCCTTTCAGTGGCTTGGCTGGG - Intergenic
1125160023 15:36632291-36632313 CTCCTCTCTGTGCTTCAGAGGGG - Intronic
1127049171 15:55062524-55062546 TCCCTCCCTGTGCCATGGATTGG - Intergenic
1127769029 15:62215768-62215790 CTCCTCTCTCTCCCCTGAATGGG - Intergenic
1127806352 15:62524518-62524540 CTCCTTTCTGAACCTTGGATAGG + Intronic
1128712812 15:69884864-69884886 TACCTCTCTGAGCCTTGGAAGGG - Intergenic
1130649271 15:85752764-85752786 CTCCTCTCACTGCCCTGGGTTGG + Intergenic
1131311311 15:91292795-91292817 ATCCTCTCCCTGCCTTGGACTGG - Exonic
1132952377 16:2570498-2570520 CTCCTCTCTGTGCCGGGGGTGGG - Intronic
1132961974 16:2629672-2629694 CTCCTCTCTGTGCCGGGGGTGGG + Intergenic
1133374705 16:5274727-5274749 CACCTCTCAGTCCCTTGCATAGG + Intergenic
1133866923 16:9652608-9652630 CTCTTCTCTGTGCCTGGAATTGG + Intergenic
1134911862 16:18034719-18034741 CTCTTCTCTGTGCTTTTTATCGG - Intergenic
1137387190 16:48052556-48052578 CCCCTCTATGTTCCTTGGCTGGG + Intergenic
1137554316 16:49461098-49461120 TTCCTGTCTGTGCCTTGAAAGGG - Intergenic
1138118392 16:54378685-54378707 CTCCTCTCTCTCTCTTGGTTGGG + Intergenic
1139073950 16:63419928-63419950 CTCCTCTCTTTCCCTGGCATAGG + Intergenic
1139267825 16:65656504-65656526 CTGCTGTCTGTGACTTGGACTGG - Intergenic
1140141647 16:72264018-72264040 CTGCTCTGTGTGGCTGGGATCGG + Intergenic
1140276989 16:73518487-73518509 CTCCTCTCAGTCCCCTGAATGGG - Intergenic
1141422032 16:83923800-83923822 CTCCTCTCTGGGCCTTTGCGTGG - Exonic
1141493895 16:84393616-84393638 CTCTTTTCTGGGCCTTGCATTGG - Intronic
1142436464 16:90061858-90061880 ATCCCTTCTGTGCCTTTGATGGG - Intronic
1142500657 17:331162-331184 CTCCTCTCTGTCCTGTGGACTGG - Intronic
1142578482 17:925345-925367 CTCCTCTGTGTTCCTGGGTTTGG - Intronic
1142868202 17:2804078-2804100 CTCCTCCCTCTGCCTTTGCTGGG + Intronic
1143165101 17:4893623-4893645 TCCCTCCCTGTGCCTTGGAGTGG - Intronic
1143395469 17:6591866-6591888 TTCCTCACTGTGCCTAGAATGGG - Intronic
1144504124 17:15815731-15815753 ATCCCCTCTGTGCCTTGCTTGGG + Intergenic
1144819135 17:18059183-18059205 CTCCTCGCTGTGCTTTTGGTGGG + Intronic
1146938194 17:36825677-36825699 CCCCGCGCTGTGCCTTGGCTGGG - Intergenic
1146973322 17:37090554-37090576 CTCCTCTCTGTGCCTGGGTTAGG + Intronic
1148072831 17:44918162-44918184 CTCATCTCTGTGGCTAGGAGTGG + Intergenic
1148086523 17:44996911-44996933 CCCCTCTCTGTGCCTTTGCACGG - Intergenic
1148483559 17:47976085-47976107 CTTCTCTCTGGGTCTTGGGTTGG - Intronic
1148656237 17:49285877-49285899 CCCTTATCTGTGCCTTGGGTGGG - Intergenic
1149604735 17:57916657-57916679 CTCCTCTCTGTGGCCTGAAAGGG - Intronic
1149695780 17:58615145-58615167 TTCAGCTCTGTGCCTGGGATAGG - Intronic
1150440740 17:65189531-65189553 CTCAGCTCTGTGCCTTCGAGGGG - Intronic
1150496374 17:65611072-65611094 CTCCTCTGTCAGCCTTGAATAGG + Intronic
1151433328 17:74079657-74079679 CTCTGCTCTGTGCCTTGGAAGGG + Intergenic
1151679286 17:75615161-75615183 CTCTTCTCTGTGCCTGGGGCTGG + Intergenic
1151945688 17:77318726-77318748 GTCCGCTCTCTGCCTGGGATAGG - Intronic
1152318970 17:79597398-79597420 CTCCTCTTTCTGCCCTGGGTGGG - Intergenic
1154359297 18:13645616-13645638 TTCCTATCTTTGCCTTTGATGGG - Exonic
1154380750 18:13848068-13848090 CTCCTCTCTGTGGCCTGCCTTGG - Intergenic
1156428749 18:37047100-37047122 TTCCTTTTTGTGCCTTGGCTAGG + Intronic
1157160112 18:45306249-45306271 ATCCTTTCTGTGCTTTGAATGGG - Intronic
1157319368 18:46622552-46622574 CTGCTCTCTGTGGCCTGGAATGG + Intronic
1159117591 18:64133229-64133251 CTCTTCTCTGTTCCTTACATTGG - Intergenic
1159530732 18:69652169-69652191 ATCCTCTCTGTTTCATGGATTGG - Intronic
1159566478 18:70056653-70056675 CTCCTTGCTGTTTCTTGGATAGG + Intronic
1160763543 19:797484-797506 CTGCTCTGTGTGCCATGGACGGG + Exonic
1161456413 19:4371898-4371920 CTCCGCTCTGTGCCTGGCACTGG - Intronic
1161462076 19:4403349-4403371 CTCCTCCGTGTGCCTTGGAATGG + Intronic
1161466681 19:4434820-4434842 CTCCTGTCTGTGCCTTACACCGG - Intronic
1162124271 19:8490811-8490833 CTTCTTTCTGAGCCTGGGATCGG + Intronic
1163188546 19:15658583-15658605 CTCCTCTAGGAGCCTTGGAATGG - Intronic
1163216243 19:15879554-15879576 CTCCTCTAGGAGCCTTGGAATGG + Intronic
1164120152 19:22258662-22258684 CTCCTGCCTGTGCCTTACATGGG - Intergenic
1167140989 19:47650704-47650726 CTCCCTGCTGTGCCCTGGATTGG + Intronic
1167800748 19:51739775-51739797 CTCCTCTCTGTGCCCTGGGGAGG + Intergenic
926730763 2:16034039-16034061 CTCCTCACTGTCCCTTGTAGGGG + Intergenic
927066050 2:19472084-19472106 CTCATCTCTTTGGTTTGGATTGG - Intergenic
927636162 2:24818850-24818872 CTCCTATCTGTGCCTGGGCAAGG - Intronic
928376325 2:30777529-30777551 CTTCCCTCCGTGCCCTGGATAGG - Intronic
929075295 2:38075384-38075406 CTCCTCTCTGTCCCCAGCATGGG - Exonic
929860094 2:45669481-45669503 CTCTGCTCTGTGCCTGGGACTGG + Intronic
931105976 2:59056175-59056197 CTTCTCTCTGTGCCTTCAAAAGG - Intergenic
931804508 2:65790853-65790875 CTCCTCTATGTGACTTGAAGGGG - Intergenic
934476113 2:94594708-94594730 CTCCTTTCTGTCCCTGGGCTCGG + Intronic
934915915 2:98300841-98300863 CTCCTCTGTGTCCCCTGTATTGG + Intronic
936312695 2:111398849-111398871 CTCGTCCCTGTGCCTGGGAAGGG - Intergenic
936382922 2:112003635-112003657 CTCTTCTAAGTGTCTTGGATTGG + Intronic
936831172 2:116649452-116649474 CTCCTATCAGTGCCTTCTATTGG - Intergenic
937281584 2:120720968-120720990 CTCCTCTTGGTGCCTCTGATAGG - Intergenic
937322000 2:120966571-120966593 GTCCTCTCTATGCCTTGGAGAGG + Intronic
937472964 2:122189344-122189366 CTCCTCTATGTGGGTGGGATGGG + Intergenic
938146125 2:128836059-128836081 GTCTTAGCTGTGCCTTGGATGGG + Intergenic
938262747 2:129907000-129907022 CTCCTGTCTGTGCCTGGCGTAGG + Intergenic
938666813 2:133547090-133547112 CCCCTTTCTTTGCCTTGGAAAGG - Intronic
938735877 2:134186296-134186318 CTCCTCTCTGCCCGTTAGATTGG - Intronic
939068371 2:137511111-137511133 TTCCTCTCTCTTCTTTGGATTGG + Intronic
940635891 2:156296238-156296260 CCTCTCTGTGGGCCTTGGATTGG + Intergenic
945320141 2:208411524-208411546 CTACTCTCTGTGCATTGGCAAGG - Intronic
946200625 2:218068900-218068922 CTCGTCTCTGTCACTTGGTTGGG - Intronic
946248701 2:218400690-218400712 GTCCTCTCTGTGCCTCCGAGGGG - Intronic
947044350 2:225963174-225963196 TTCCTCTCTGTGCCTCTAATTGG - Intergenic
948388618 2:237597000-237597022 CTCCTCTCTGTGGCCTGGAGTGG - Intronic
1169253748 20:4081979-4082001 TTTCTCTCTGTTGCTTGGATTGG + Intergenic
1169575841 20:6960302-6960324 ATCTTTTATGTGCCTTGGATAGG - Intergenic
1169640755 20:7748757-7748779 CTCCTCACTGGGCCTTGCCTTGG - Intergenic
1169727661 20:8753510-8753532 CTCTTCTCTATGCCTTTGCTTGG + Intronic
1171305918 20:24105536-24105558 CTCTGCTCTGTCCCTTGGCTTGG - Intergenic
1171971510 20:31567984-31568006 CTGCTCTCTGCTCCTTGGAAAGG + Intronic
1173638935 20:44585499-44585521 CACCTCTCTGTGCCTTTCTTAGG - Intronic
1173951716 20:46998594-46998616 CTCCTCTGGGAGCCTTGGATGGG - Intronic
1174223755 20:48979557-48979579 CTCCTCTTTGTACCTCTGATAGG + Intronic
1175551805 20:59822345-59822367 CTCCGCACTGGGCCTAGGATGGG + Intronic
1176263951 20:64198897-64198919 CACCTCGCAGGGCCTTGGATCGG - Exonic
1176281861 20:64317851-64317873 CTTGTCTCTCTGCCTGGGATGGG + Intergenic
1179411319 21:41165815-41165837 CTCCTTTCTCTGCCCTGCATCGG + Intergenic
1179941252 21:44639820-44639842 GTCCTGTCGGTGCCTTGGACAGG - Intronic
1180243923 21:46533607-46533629 CTCCTGTCTGTGCCTTGGGGAGG - Exonic
1182491975 22:30678956-30678978 CTCCTCTCTCTCCCTTTAATGGG - Intergenic
1182662950 22:31937829-31937851 CTGCTCTCTGTGCTGTGGCTGGG + Intronic
1183025995 22:35066363-35066385 CTCTTCTCTGTGCCAGGGCTGGG - Exonic
1183624821 22:38995417-38995439 ACCCTCTCTGTGCCTTGGCTTGG + Intergenic
1183898289 22:40986405-40986427 CCCCTCTCTGGGCCTTGGAAGGG + Intergenic
1184992699 22:48181666-48181688 CTCCTCCCTGTGCTTTGGTTTGG - Intergenic
1185077700 22:48692060-48692082 CTCCTCCCTGAACCTGGGATGGG + Intronic
953513266 3:43565329-43565351 CTGTTTTGTGTGCCTTGGATGGG - Intronic
953743528 3:45556349-45556371 CTCCTCACTGCTTCTTGGATAGG + Intronic
954151142 3:48657705-48657727 CTCCTCTCTGTGTCCTGAGTTGG - Intronic
954363784 3:50135820-50135842 CTCCTCCCTGTGCCCTGGTTAGG - Intergenic
955690237 3:61583602-61583624 CTCCTCTCTGTGTTCTTGATGGG + Intronic
956640075 3:71407104-71407126 CTCCACTCTGTTTCTTGCATTGG + Intronic
960050592 3:113235390-113235412 CTCCTCTCTGGGGCTGGGAGTGG + Intronic
960371039 3:116840004-116840026 CTCTTCTCTGTCCCTATGATAGG + Intronic
960694859 3:120386152-120386174 CTCCTCACTGTGTCTTCGCTTGG - Intergenic
963119300 3:141762906-141762928 CTCCTTTCTTTGACTTGGAAAGG + Intergenic
963232969 3:142927467-142927489 CTCCTCTCTGTGCCTTCACTTGG + Intergenic
963260675 3:143188234-143188256 CTCCTCTCTCTGGCATGGCTTGG + Intergenic
963864100 3:150341804-150341826 CCCCTCTCAGGGCCTTGGAGAGG + Intergenic
964233594 3:154498890-154498912 CTCCTATTTCTGGCTTGGATGGG + Intergenic
964918411 3:161865015-161865037 CTTCTTTGAGTGCCTTGGATTGG + Intergenic
968190872 3:196666190-196666212 CTCTTCTCTGGGCCTAGCATGGG + Intronic
968260567 3:197320232-197320254 TTCCTCTCTGTGCTTTGGTTTGG + Intergenic
968563600 4:1297619-1297641 CATCTCTCTGTGCTTTGGTTGGG + Intronic
969589281 4:8112483-8112505 CTGGTCTCTGAGCCTTGGAGAGG - Intronic
971143747 4:23952695-23952717 TTCCTCTCAGGGCCTTGGAAGGG + Intergenic
971315759 4:25566526-25566548 CTTCTCTCTGTGACTTGGCAGGG + Intergenic
972374381 4:38456908-38456930 CTCCTCCCTGTGAGTTGGATTGG + Intergenic
973015512 4:45132864-45132886 CTCCTCTCTGTGCCACGACTTGG + Intergenic
975272114 4:72448126-72448148 CCCCTCTCTGAGCCTTAGTTTGG - Intronic
975296276 4:72738188-72738210 CTCCCCTTTCTGCCTGGGATCGG - Intergenic
976402566 4:84623894-84623916 CCCCTCCATGTGGCTTGGATGGG + Intronic
976599894 4:86928420-86928442 CTCCTCCCAGTGCCTTCCATTGG + Intronic
977798911 4:101201918-101201940 CTCCTCTCACTGCCTAGCATGGG - Intronic
979227767 4:118309307-118309329 CTCCTCACTGTGACTTGCATGGG + Intronic
980869003 4:138589156-138589178 CTCCTCTCAGTTCCTTTCATGGG + Intergenic
981008912 4:139904289-139904311 GTCCTCTCAGTGTCTTAGATGGG + Intronic
985161433 4:187048524-187048546 GTCCTCTCTGTGCCTATGGTTGG - Intergenic
985708983 5:1417685-1417707 CCCTTCCCTGGGCCTTGGATGGG + Intronic
985934198 5:3082014-3082036 CTCCTTTCTCTGCCTGGGTTTGG + Intergenic
986959067 5:13191458-13191480 CTTCTGTCTGTGCCATGGTTTGG + Intergenic
987876552 5:23688171-23688193 CTCCTCTCTCTCCCTTTAATGGG + Intergenic
988713277 5:33799786-33799808 CCCCTTCCTGTGCCTTTGATTGG - Intronic
988846404 5:35132167-35132189 CTCCTCCATGTGTTTTGGATAGG - Intronic
988997327 5:36726943-36726965 CTTATCACTGTTCCTTGGATGGG - Intergenic
990513377 5:56509825-56509847 CTTTTCTTTGTGCCTTGAATTGG + Intergenic
990593904 5:57294173-57294195 CCCATCTCTGTAGCTTGGATGGG - Intergenic
992101622 5:73413374-73413396 CTCCTTGCTGTGCCTTTGTTGGG - Intergenic
994388024 5:99155557-99155579 CTCCTCTCTTTGCCTTCTTTTGG - Intergenic
994439010 5:99778308-99778330 CCCCTCTCTGTGCTTTAAATGGG - Intergenic
994710105 5:103256182-103256204 CTCCTTCCAGTGCCTTGCATTGG - Intergenic
994851132 5:105056920-105056942 CTCCTCTCTGCTCCATGGAGTGG - Intergenic
998638076 5:143979356-143979378 CTCCTATGTGAGACTTGGATTGG + Intergenic
999250420 5:150179310-150179332 CTCCTCTCTGGGCTCTGGAGAGG - Intronic
999418421 5:151419863-151419885 GTCCTCTCCTTGCCTGGGATGGG - Intergenic
1001070213 5:168579314-168579336 CTGCTCTCAGTGCCCCGGATCGG - Exonic
1001407343 5:171485416-171485438 CTCCTGTCTGGGGCTTGGAGAGG - Intergenic
1006327130 6:33362823-33362845 CTCCTCTCTCTGTCTTTGAGGGG + Intergenic
1006336294 6:33422560-33422582 CTCCTCACTGTGCCTTGAGAAGG + Intronic
1007192542 6:40031814-40031836 CTCCTCCCTCTGAGTTGGATGGG - Intergenic
1007768676 6:44176723-44176745 CTCCTCTCTGTGCCTTGGATGGG + Intronic
1008295378 6:49769321-49769343 CTCCCTTCTGTGGCTGGGATAGG - Intergenic
1008360598 6:50613213-50613235 CTCCTCTTACTGCCTTGGAAGGG - Intergenic
1009294093 6:61922327-61922349 CTCCTCTCTGTGCCATAATTTGG - Intronic
1010956979 6:82101529-82101551 CCCCTTTCTGTGACTTGGAAAGG - Intergenic
1012943605 6:105442851-105442873 CTCCTCACTGTCCCCTGAATAGG + Intergenic
1013097727 6:106961198-106961220 GTGCCCTCTGTGCCTTGGAAAGG + Intergenic
1013292795 6:108733116-108733138 CTCCTCTCTCTGCCTTCCAGAGG + Intergenic
1013588893 6:111603832-111603854 CTCTGCTCTGTTCCTTGCATGGG - Intronic
1018305147 6:162447173-162447195 CTCCTCTAGGTGCCTAGAATAGG - Intronic
1018968079 6:168504159-168504181 CTCCTCTGGGTTCCTTAGATGGG + Intronic
1021638463 7:22714553-22714575 CTTCTCTCTGTGCCTTCTGTAGG - Intergenic
1021768736 7:23976924-23976946 AGCCTCTCTGTGCCTTTGGTTGG + Intergenic
1022120182 7:27300569-27300591 CTTCTCACTGTGGCTTGGTTAGG + Intergenic
1022473194 7:30694282-30694304 CGCCTCTCAGTGCCTGGCATGGG + Intronic
1023891252 7:44393417-44393439 CTCCTCTGTGTCCCTGGGACAGG - Intronic
1024257622 7:47550192-47550214 CTCGCGTCTGGGCCTTGGATAGG - Intronic
1026134631 7:67648939-67648961 CCCCTCTCTGTGCCCGGGTTAGG - Intergenic
1026158464 7:67848336-67848358 ATCCTCTCTGTGCCCTACATAGG - Intergenic
1027239052 7:76315421-76315443 CCACTCTCTCTGCCTTGGAAGGG + Intergenic
1029233377 7:99090482-99090504 CTCCTCTCTGTCCCTTTGCTGGG - Intronic
1030099422 7:105932417-105932439 CTCCTGTCTGTGCATGGGAATGG + Intronic
1030451560 7:109719348-109719370 CTCCTTTCTTTGACTTGGAAAGG - Intergenic
1030506216 7:110426339-110426361 TTCCTCTCTGTGCTTCGGTTTGG - Intergenic
1031850662 7:126858870-126858892 CTCCTTTCTGTTCCTTGAACAGG + Intronic
1032761547 7:134947747-134947769 CTCCTCTCTGAGTTTTCGATCGG - Exonic
1033592399 7:142821496-142821518 CCCCTCTCTGTGCCATGGCCTGG - Intergenic
1035410583 7:158637516-158637538 CTCCTGTGTGTGGCTCGGATGGG - Intronic
1036421502 8:8600193-8600215 CTGCTCTCTTTGCCTTGCTTTGG - Intergenic
1037760518 8:21738662-21738684 CTTCTCTCTGTTCCTTGCAGAGG - Intronic
1038300909 8:26346891-26346913 CTCTTCTCTGTGCCTCAAATTGG - Intronic
1039107974 8:34009917-34009939 CCCCTCTCAGGGCCTTGGATAGG - Intergenic
1040427464 8:47303345-47303367 CTCCTTTCTGTGACTAGGAAAGG + Intronic
1041361461 8:57058982-57059004 TTCCTCTCCTTGCCTTTGATGGG - Intergenic
1044295352 8:90520718-90520740 CTCCTCTCTCTTACTAGGATTGG - Intergenic
1045942338 8:107754116-107754138 CTCCTTTTTGTGCCTCAGATGGG + Intergenic
1046902169 8:119535388-119535410 CTCCTTTCTGAGCCTTGGAGAGG - Intergenic
1047300305 8:123608452-123608474 CTCCACTCTCTGCCCTGGACAGG - Intergenic
1047620425 8:126600901-126600923 TTCCTCTTTGTTCTTTGGATGGG + Intergenic
1047788094 8:128173999-128174021 ATCCACTCAGTGCTTTGGATTGG - Intergenic
1048510785 8:135060402-135060424 CCCCTCTCTGTGCTTTGCCTAGG + Intergenic
1048645093 8:136411105-136411127 CCCCTCTCTTTTCCTTGCATAGG + Intergenic
1050180403 9:2916736-2916758 CTCCTCTCTTTGCCAAGGAAGGG - Intergenic
1052325610 9:27214285-27214307 ATCCTCTCTTTTCCTTGGGTGGG + Intronic
1052634186 9:31079760-31079782 CTCTTCTCTGTATCTTGGTTTGG - Intergenic
1053270304 9:36744986-36745008 CTTCTCTCTGAGCTTTGGTTGGG + Intergenic
1054947990 9:70817259-70817281 TTCCTCACTGTGCCTTCGAAAGG + Intronic
1058952458 9:109916451-109916473 CTCAGCACGGTGCCTTGGATAGG - Intronic
1058975395 9:110121414-110121436 CTTCTCTGTGTGCCTTGAATTGG + Intronic
1059282831 9:113149517-113149539 CACCTCTCTGGGCCTTACATGGG - Intergenic
1059411525 9:114135299-114135321 CTCCTCTCTGGGCCTGTGCTTGG + Intergenic
1061204409 9:129154760-129154782 CTCCTGCCTGGGCCCTGGATGGG + Intergenic
1061273617 9:129557672-129557694 CTCCTCGCTGGGCCTTTGTTGGG + Intergenic
1062615457 9:137394037-137394059 CTGCTCTCTGTGCCGGGGACGGG - Intronic
1189141101 X:38606943-38606965 CTCCTCTCTGAGTCTTGGTGTGG + Intronic
1190104803 X:47552055-47552077 CTCCTCTCTGTGCTATGGCCTGG - Intergenic
1190572368 X:51796843-51796865 CTTCTCTCTGTGCCTCAGACTGG + Intergenic
1191211867 X:57892775-57892797 CTCCTCTTTCTCCCTTGGCTGGG - Intergenic
1194040170 X:88931358-88931380 CTCCTCTCTGAGATTTTGATTGG - Intergenic
1198729423 X:139712688-139712710 CCACTCTCTGTGCCCTGGGTTGG - Intergenic
1202368684 Y:24183206-24183228 CTCCTCTGTGTGGCCCGGATGGG + Intergenic
1202502101 Y:25486911-25486933 CTCCTCTGTGTGGCCCGGATGGG - Intergenic