ID: 1007769339

View in Genome Browser
Species Human (GRCh38)
Location 6:44180521-44180543
Sequence GGGGGTTGGAAGGAAGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 318}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007769330_1007769339 5 Left 1007769330 6:44180493-44180515 CCAAGAGGTGAGGGGAGACTGTA 0: 1
1: 0
2: 2
3: 5
4: 229
Right 1007769339 6:44180521-44180543 GGGGGTTGGAAGGAAGCTCCTGG 0: 1
1: 0
2: 1
3: 26
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007769339 Original CRISPR GGGGGTTGGAAGGAAGCTCC TGG Intronic
900001180 1:15700-15722 GGGGGTGGGCAGAAAGCACCCGG + Intergenic
900020895 1:186221-186243 GGGGGTGGGCAGAAAGCACCCGG + Intergenic
900105138 1:978000-978022 GGGGGTTGGGAGGCGGTTCCTGG - Intronic
900105153 1:978030-978052 GGGGGTTGGGAGGCGGTTCCTGG - Intronic
900367759 1:2318204-2318226 CGGGGTGGGGAGGAAGATCCTGG - Intergenic
900497238 1:2981386-2981408 GGGGGATAGAAGGAAACTTCTGG - Intergenic
900647195 1:3714353-3714375 GGGGATTGGAAGGGTGCCCCAGG - Intronic
900652304 1:3735690-3735712 AGGGGTTGGAGGGAGGCTGCTGG + Exonic
903383581 1:22912849-22912871 GGGGGTTGGTAGGAAGGTTGAGG + Intronic
903462483 1:23529561-23529583 GGGTTTTGGAAGCAGGCTCCAGG - Intronic
904039099 1:27574186-27574208 GGGGGCTGGCAGAGAGCTCCAGG - Intronic
904482960 1:30805525-30805547 GGGGGTGGGAAGGGGGCTGCCGG + Intergenic
904485957 1:30824667-30824689 GGATGTTCGGAGGAAGCTCCGGG + Intergenic
904800806 1:33092012-33092034 GGTGGTTGTAAGGAGGCACCAGG - Intronic
906220121 1:44071897-44071919 GGGGGTGGAGGGGAAGCTCCAGG - Intergenic
907759291 1:57342188-57342210 AAGGGTTGGAAGGAAGTTCCAGG - Intronic
910388010 1:86705203-86705225 CAGGGGTGGGAGGAAGCTCCCGG - Intronic
910951612 1:92654002-92654024 GGGGGTGGCAGGGAAGCTCCTGG - Intronic
911129966 1:94377558-94377580 GAGGGAGGGAAGGAATCTCCAGG + Intergenic
912704278 1:111900303-111900325 GAGGTTTGGAAGGCAGGTCCGGG - Intronic
913191088 1:116413591-116413613 AGGGGTTGGGAGGAGGCTCCTGG + Intergenic
913470780 1:119183097-119183119 GAGGGTTGGAAGTCAGCTGCGGG + Intergenic
914203259 1:145505323-145505345 GGGGGTTGGAAGGTATCTGTGGG - Intergenic
914237188 1:145823246-145823268 GGGGGTTGGAAGGTATCTGTGGG - Intronic
914482381 1:148078477-148078499 GGGGGTTGGAAGGTATCTGTGGG - Intergenic
915073071 1:153288396-153288418 GGGGTTGGGAAGGAAGCTTGGGG + Intergenic
915589941 1:156864934-156864956 GGGAGATGGGAGGAAGCCCCAGG - Intronic
917735224 1:177914094-177914116 GGGGGTTGGTAGGGAGCTGAAGG - Intergenic
919897536 1:202018518-202018540 GGGGGTGGGGAGGAAGCCACAGG + Intergenic
920092825 1:203466179-203466201 GGGGGTTAGAAGGAGGGGCCTGG + Intergenic
920229666 1:204461954-204461976 GGGGGTGGAAAGGACGCTCCGGG - Intronic
922542636 1:226430491-226430513 GGGTGTTACAATGAAGCTCCTGG - Intergenic
1062857038 10:784630-784652 GGGGATGGGAGGGAGGCTCCCGG - Intergenic
1063112181 10:3046841-3046863 GGGGGATGGAAGGTGGCTCCAGG - Intergenic
1065556108 10:26917190-26917212 GGGGGATGGTAGGAAATTCCAGG + Intergenic
1065828659 10:29595168-29595190 CGGGCATGGAAGGAAGCCCCAGG + Intronic
1066464717 10:35641659-35641681 GGGGGTTTGAAGGCGGCTGCAGG + Exonic
1070693623 10:78545491-78545513 AAGGGTTGGCAGGAAGCTGCTGG + Intergenic
1072570181 10:96651757-96651779 GGGGGCTGGAAGAAAGATCTTGG + Intronic
1072622773 10:97090892-97090914 GGGGGTGGCAAGCAAGCCCCTGG + Intronic
1073049125 10:100656450-100656472 GGGTGGGGGAGGGAAGCTCCGGG - Intergenic
1073227825 10:101938612-101938634 GGGTGTTTGAATGAAGCACCAGG - Intronic
1073267965 10:102239960-102239982 GGAGGTGGGAAGGAGGCTCATGG - Intronic
1073728984 10:106268607-106268629 GGGGTTTGGGAGGAAGTTCCTGG - Intergenic
1074769254 10:116722887-116722909 GGGTGGGGGAAGGTAGCTCCAGG + Intronic
1074777499 10:116777016-116777038 GGAGGTTGTAAGAAAGCTCCTGG + Intergenic
1075702921 10:124480956-124480978 GGGGGTTATAAGGAGGCTGCAGG + Intronic
1076103008 10:127797762-127797784 GGGGGATGGATGGAAGATGCGGG - Intergenic
1076667885 10:132103213-132103235 TGGGGATGGAAGGAGGCCCCAGG + Intergenic
1077519588 11:3024358-3024380 GGGGGTTGAAATCATGCTCCTGG - Intronic
1077894139 11:6441160-6441182 GGGGGTTGGGGGGCAGCTGCCGG - Intronic
1077976130 11:7251204-7251226 GAGAGTTGGAAGGAACCTCAGGG - Intronic
1079697201 11:23496382-23496404 GAGGGATGGAAGGAGGCCCCCGG - Intergenic
1080926972 11:36767755-36767777 GGGGTTAAGAAGGAAGGTCCTGG + Intergenic
1080966885 11:37224070-37224092 GTGGCTGGGCAGGAAGCTCCAGG + Intergenic
1081747539 11:45483569-45483591 GGGGGTGGGAATGAAGCTGCCGG + Intergenic
1083048597 11:59757155-59757177 CGGGGTAGGAGGGATGCTCCAGG + Intronic
1083931941 11:65850927-65850949 GGGTGTGGGAAGGAAGCCACTGG + Intronic
1084597227 11:70124178-70124200 GGGGATGGGAAAGAAGCTTCTGG - Intronic
1084720722 11:70903999-70904021 AGGGGTTTGGAGGAAGCACCAGG - Intronic
1086903941 11:92397698-92397720 GGGGGATGGAAGGCAGTTTCTGG - Intronic
1087072373 11:94093910-94093932 AGGGGTTGGAAAGAAGCTTTAGG - Intronic
1087174436 11:95083021-95083043 GGGAGGTGGAAGGAAGCACCAGG + Intergenic
1088402258 11:109434169-109434191 GGGAGTTCAAAGGAAGCTTCTGG + Intergenic
1089518985 11:119051404-119051426 GGGTGTAGGATGGGAGCTCCAGG - Intronic
1089531912 11:119135404-119135426 GGGAGTGGGAAGGAAGCTGGGGG + Exonic
1090285516 11:125496037-125496059 GGGGGTGGTAAGGAGGCCCCGGG - Intronic
1090498103 11:127234288-127234310 GGGGCTGGGTAGGAAGCTGCTGG + Intergenic
1090531394 11:127594611-127594633 GGGGGTTAGAAGAAAGCTAAGGG - Intergenic
1091374269 12:15817-15839 GGGGGTGGGCAGAAAGCACCCGG + Intergenic
1091637491 12:2208554-2208576 GTGCATTGGAGGGAAGCTCCAGG + Intronic
1091757294 12:3062394-3062416 GGAGGTTTGAAGGAAGGGCCAGG - Intergenic
1091761192 12:3088447-3088469 GGGGCTGGGGGGGAAGCTCCAGG + Intronic
1092104502 12:5912053-5912075 AGGGGTTGGAAGGAGGTTTCTGG - Intronic
1092282878 12:7110546-7110568 AGGCCTTGGAAGGAAACTCCAGG + Intergenic
1095159938 12:38904963-38904985 GTGGGTGGGGAGGAAGCTGCCGG + Intronic
1097653606 12:62334055-62334077 GGGGGTCGGAGGGAAGCTGAAGG + Intronic
1101432159 12:104635472-104635494 GGGGGTTGGAAGGAGAATTCAGG + Intronic
1101711242 12:107268820-107268842 AGGTGGTGGAAGGAAGCTTCAGG - Intergenic
1101901476 12:108794162-108794184 TGGTGTTGGAAGGAAGCCACAGG - Intronic
1102014106 12:109636596-109636618 GCTGGTTGGAAAGAATCTCCTGG + Intergenic
1102033035 12:109753921-109753943 GAGGGATGGAAGGAAGGTCTGGG + Intronic
1102239458 12:111314993-111315015 GGGGGTCGGAAGCAGGCACCAGG + Intronic
1102988395 12:117297248-117297270 TGGGGTTGGAATGCAGCTGCAGG + Intronic
1103522983 12:121548793-121548815 GGAGGTGGGAAGGAGGCTCCTGG - Intronic
1103935055 12:124471202-124471224 TGGGTTTTGAAGGACGCTCCAGG - Intronic
1103937676 12:124485089-124485111 GGGGCTTGGCAGGAAGCGCATGG + Intronic
1103953520 12:124564857-124564879 GGGAGTTGGAAGCTAGCCCCAGG - Intronic
1104017253 12:124969319-124969341 GGGGGGTGGGAGAGAGCTCCCGG + Intronic
1106217450 13:27715831-27715853 GGGAGTTGGAAGGAAGATGGAGG + Intergenic
1106884408 13:34168481-34168503 GGGGGTGGGAAGCAAGGACCTGG + Intergenic
1107604926 13:42048261-42048283 GGGTGCTGGGAGGAAGCTCCAGG + Intronic
1109133513 13:58618482-58618504 GGGAGCAGGAAGGAAGCACCAGG + Intergenic
1113146961 13:107218143-107218165 GGGAGGTGGAAGGAAGAGCCTGG - Intronic
1113398226 13:109968564-109968586 GGGGGATGGCAGGAAGCCCATGG + Intergenic
1113812198 13:113149672-113149694 GGGGGCAGGATGGAGGCTCCAGG + Intergenic
1114006284 14:18317073-18317095 GGGGGATGGTAGGAAATTCCAGG - Intergenic
1114244043 14:20895896-20895918 GGGGGTTGAATGGAAGGTCAAGG + Intergenic
1114736742 14:25050063-25050085 AGGGGTTGGGGGGAAACTCCCGG + Exonic
1116397870 14:44468755-44468777 GGGGGTGGGGAGGAAGTTCAAGG - Intergenic
1119298601 14:73552916-73552938 GGGGGATGGAAGGGAGCTGGTGG - Intronic
1119302895 14:73585092-73585114 GGGGGATGGAAGGGAGCTGGTGG - Intergenic
1119778886 14:77265333-77265355 GGGGCCTGGGAGGAAGCTCTGGG - Intergenic
1120997556 14:90428077-90428099 GGGGGCTGGAAGGAAGGTGGAGG - Intergenic
1121493578 14:94377327-94377349 GGAGGATGGAAGGACTCTCCTGG + Exonic
1121900746 14:97691447-97691469 GGGGGATGAAAGGAAGCCCAGGG + Intergenic
1122852782 14:104546006-104546028 GGGGGCTGGTAGGAGGCTCCCGG + Intronic
1123112495 14:105879913-105879935 GGTGGCAGGAAGGCAGCTCCCGG + Intergenic
1123390210 15:19863735-19863757 GGGGGATGGTAGGAAATTCCAGG - Intergenic
1125913543 15:43463891-43463913 GGGGGTTGGGAGGCAGGTGCAGG - Intronic
1127286774 15:57539753-57539775 GGGGGTTGGAGGGGATCCCCAGG + Intronic
1128078531 15:64842743-64842765 AGTGGTTAGAAGGAGGCTCCAGG - Intronic
1128336084 15:66786619-66786641 GGGGCCTGGAAGGCAGCTCAGGG + Intergenic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1129273290 15:74430615-74430637 AGAGCTTGGTAGGAAGCTCCTGG + Intronic
1129851735 15:78797551-78797573 GGTGGTGGGAGGGAAGTTCCTGG + Intronic
1129904755 15:79178592-79178614 GGGGGAGGGATGGAAGCTTCTGG + Intergenic
1130696989 15:86140669-86140691 GGGGGTTGGATGGGATCTCGTGG + Intergenic
1132452329 15:101975239-101975261 GGGGGTGGGCAGAAAGCACCCGG - Intergenic
1132454567 16:15384-15406 GGGGGTGGGCAGAAAGCACCCGG + Intronic
1132513353 16:354537-354559 GGGGGTAGGCTGGAAGCTCGGGG - Intergenic
1132949483 16:2552889-2552911 CGTGGTTGGCAGGAGGCTCCTGG + Intronic
1132964865 16:2647277-2647299 CGTGGTTGGCAGGAGGCTCCTGG - Intergenic
1132999834 16:2843673-2843695 GGTGGTTGCGAGGAAGCTACTGG - Intergenic
1133242079 16:4420790-4420812 GGGGGTTGGGGGGATGCTGCTGG - Intronic
1133340270 16:5031392-5031414 GGGGCTTTGAAACAAGCTCCTGG + Intronic
1133791450 16:9012605-9012627 GGAGGGTGGCAGGATGCTCCTGG + Intergenic
1135303597 16:21350783-21350805 GATGGATGGAAGGAAGCACCAGG + Intergenic
1136300343 16:29329978-29330000 GATGGATGGAAGGAAGCACCAGG + Intergenic
1136615513 16:31395913-31395935 GGGGGATGGAAGCAAGCACCAGG + Intronic
1137017766 16:35393861-35393883 GGGTGGTGAAAGGAAGCCCCTGG + Intergenic
1137796946 16:51229358-51229380 GAGGGTGGGAAGGCAGCTCTGGG + Intergenic
1138443787 16:57050555-57050577 GGGGGTTGGGAAGTGGCTCCAGG + Intronic
1138593189 16:58014323-58014345 GGGGGTTGGGAGGACCCACCTGG - Exonic
1140442462 16:74998728-74998750 GGGGGTGGGAAGGAAACACCGGG - Intronic
1142128310 16:88421006-88421028 GGGGCTGGGAAGGAAGGGCCAGG + Intergenic
1142356411 16:89603934-89603956 GGGGGCTGGCAGGAAGCACTGGG + Intergenic
1142356491 16:89604137-89604159 GGGGGCTGGAGGGAAGCACTGGG + Intergenic
1142356601 16:89604422-89604444 GGGGGTTGGAGGGGAGCACTAGG + Intergenic
1142356632 16:89604524-89604546 GGGGGCTGGAGGGAAGCACTGGG + Intergenic
1142610457 17:1106990-1107012 AGCGGTGGGAAGAAAGCTCCTGG - Intronic
1142721102 17:1776446-1776468 GGGAGAGGGAAGGCAGCTCCTGG + Intronic
1142740659 17:1930141-1930163 GGAGGTTGGGAGGAGGCACCAGG - Intergenic
1142888069 17:2925672-2925694 GGGGCTTGGAAGGTACTTCCAGG + Intronic
1143327818 17:6110954-6110976 GGACGATGGAAGGCAGCTCCCGG + Intronic
1143404436 17:6667812-6667834 GGGGGTGGGAAGGAAGCAGTGGG + Intergenic
1143752281 17:9037108-9037130 GGGGGTTGGGAGGAGCCTTCTGG - Intronic
1144006201 17:11102004-11102026 CGGGGGCTGAAGGAAGCTCCAGG - Intergenic
1144967506 17:19087327-19087349 GGTGGCTGGAAGGCAGGTCCTGG + Intergenic
1144980413 17:19164738-19164760 GGTGGCTGGAAGGCAGGTCCTGG - Intergenic
1144987809 17:19213494-19213516 GGTGGCTGGAAGGCAGGTCCTGG + Intergenic
1145124212 17:20286882-20286904 GGGGGTTGGAGGGAAGAGGCAGG - Intronic
1145270083 17:21400215-21400237 GGGGGTGGGGAGCAAGCTCCTGG + Intronic
1145308306 17:21687664-21687686 AGGGGTGGGGAGCAAGCTCCTGG + Intergenic
1146126826 17:30237220-30237242 GGGGGTTGCAGGGGAGATCCTGG + Intergenic
1146312492 17:31779953-31779975 GGGGGTGGGTGGGAGGCTCCTGG - Intergenic
1146547020 17:33748644-33748666 GGGAGGTGGAAGGAATCCCCAGG - Intronic
1147256799 17:39186453-39186475 GGGGTTTGGGAAGAAGCTCCTGG - Intronic
1147367878 17:39971192-39971214 AGGGCTTGGATGGAAGCTCTAGG + Intronic
1147585956 17:41654201-41654223 GGGCCTTGTAAGGAAGCTTCTGG - Intergenic
1147860819 17:43521921-43521943 TAGGGCTGGAAGGAAGGTCCTGG + Intronic
1148668752 17:49394460-49394482 GGAAATTGGAAGGAAACTCCTGG + Intronic
1148852630 17:50562138-50562160 GGCGGTGGGGAGGAAGCTGCGGG + Intronic
1149303176 17:55324258-55324280 GTGGGTTAGAAGGAACCTCTGGG - Exonic
1150104692 17:62453747-62453769 CGGGGCTGGAAGGTGGCTCCAGG + Intergenic
1150709483 17:67518371-67518393 GGGGGCTGGAAGGCATCCCCTGG - Intronic
1151283297 17:73092394-73092416 GGCGGTGGGAAGGAAGTCCCCGG - Intronic
1152057423 17:78040953-78040975 GGGAGCTGCCAGGAAGCTCCCGG - Intronic
1152141013 17:78536748-78536770 GGGGGTTGGAAGGATGATGAGGG + Intronic
1152285992 17:79413693-79413715 GGGGGCTGGAAGGCAGCCCGAGG + Intronic
1152547218 17:81006943-81006965 GAGGGCTGGAAAGAAGCTCCTGG - Intronic
1153561419 18:6375424-6375446 GGTGGTGGGAAGGTGGCTCCAGG - Intronic
1157588409 18:48819970-48819992 GGAGGATGGAAGGAAGTGCCCGG + Intronic
1158260168 18:55597810-55597832 GGGGGTTGGAGGGCAGCTTTTGG - Intronic
1158648951 18:59269648-59269670 GGTGGAAGGAAGGAAGATCCGGG - Intronic
1160294985 18:77629697-77629719 GGAGTTGGGGAGGAAGCTCCAGG - Intergenic
1160841167 19:1147604-1147626 GGGGGTGGGAGGGCAGCCCCAGG - Intronic
1162130380 19:8522606-8522628 TGGGGTGGGAGGGCAGCTCCAGG - Intronic
1163870722 19:19819401-19819423 TGGGGTTGAAAGGCAGATCCTGG - Intronic
1165331586 19:35143383-35143405 GGGGGTTGCAGGGGGGCTCCGGG + Intronic
1165888879 19:39098897-39098919 TGGGGTTGGAGGGAGGGTCCCGG + Intronic
1166217008 19:41342329-41342351 GGAGGCAGGAAGGAAGCCCCTGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166948779 19:46412949-46412971 GGGGGACGGCAGGAAGCCCCAGG + Exonic
1168354490 19:55692807-55692829 GGGGGTGGGAATGGAGCCCCGGG + Intronic
1168709688 19:58491877-58491899 GGCGGTTGGAAGGAACCTTCTGG - Intronic
925821389 2:7802856-7802878 GGTGGTTGGAGAGGAGCTCCGGG + Intergenic
926066265 2:9843081-9843103 GGGGCTTGGAGGAAAGCTCACGG - Intergenic
927897334 2:26792248-26792270 AGGGGTTGGTGGGAAGCTCCCGG - Intronic
929461702 2:42106651-42106673 GGAGGGTGGAAGAAAGCCCCGGG - Intergenic
929788902 2:45009904-45009926 GAGGGGTGGAAGGAGACTCCAGG + Intergenic
929868234 2:45736358-45736380 GGGAGTTGGAAGGCTGCTCTGGG + Intronic
929989948 2:46778452-46778474 GGAGGTGGGAGGGAAACTCCAGG + Intergenic
931550951 2:63445625-63445647 AGGGGTTGGAGGGAGGCTTCTGG + Intronic
933703117 2:85270102-85270124 TGTGGCTGGAAGGCAGCTCCAGG + Intronic
933790038 2:85876379-85876401 GGGGGCTGGAAGGAACCTTCAGG + Intronic
935103774 2:100020772-100020794 GGGGGCTGGAAGGGAGCCCATGG - Intronic
936761859 2:115795488-115795510 GGAGAATGGAAGAAAGCTCCAGG - Intronic
937837915 2:126492630-126492652 GGGGGTTGGCGGGGAGCTTCTGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938937720 2:136141920-136141942 GGTGGGAGGAAGGAAGCGCCGGG + Intergenic
940046612 2:149416606-149416628 GGGCGTTGTAAGGGAGGTCCTGG - Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942613277 2:177763598-177763620 TGGGGTGGGTAGTAAGCTCCCGG + Intronic
944770801 2:202912453-202912475 GGGGGTTGGGAGGTAGCGTCCGG - Intronic
944887919 2:204084093-204084115 GGGGGTGTGATGGCAGCTCCAGG - Intergenic
946312037 2:218887429-218887451 GGAGGATGGAACCAAGCTCCTGG - Intronic
947517087 2:230815344-230815366 GGGGGTTGGACAGAACTTCCTGG + Intronic
948149126 2:235730954-235730976 GGGGGTTGGGGGTAAGCTGCAGG - Intronic
948646138 2:239406365-239406387 GGGGTTTGGGAGGAGGCCCCAGG + Intergenic
1170608897 20:17895485-17895507 GGGGGTGGGCAGGGAGCTTCTGG - Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1172651039 20:36501573-36501595 GGGTGGTGGAAGGCAGGTCCTGG + Intronic
1172874731 20:38157199-38157221 GGGGGCTGGGAGGGAGCCCCTGG - Intronic
1173525312 20:43727801-43727823 GGGGGGTGGGAAGGAGCTCCAGG - Intergenic
1174340869 20:49894295-49894317 GGTGGTTGAAAGGAACCACCAGG - Intergenic
1174485402 20:50857958-50857980 GGTGGATGGAAGGAAGCTCCAGG - Intronic
1176195667 20:63835515-63835537 TGGGGTTGGCAGGTAGCCCCTGG - Intergenic
1176208901 20:63907549-63907571 GGGGGTGGGAGGGTAGCTCTGGG - Intronic
1176766221 21:13021349-13021371 GGGGGATGGTAGGAAATTCCAGG - Intergenic
1178431108 21:32519752-32519774 GGTGGCTGGGAGGAAGCTGCTGG + Intergenic
1178437845 21:32575414-32575436 GGGGGTGGGCAGGAAGCCCGGGG + Intergenic
1178533709 21:33395712-33395734 GGGGGTGTGTAGGGAGCTCCAGG + Intergenic
1178589204 21:33895075-33895097 CTGGGTGGGAAGGAAGCTCGCGG + Exonic
1179463784 21:41557079-41557101 GGAGGTTGGCTGGAAGCTGCTGG + Intergenic
1179979829 21:44890141-44890163 AGGAGCTGGAAGGAAGCTGCCGG - Exonic
1180430795 22:15247886-15247908 GGGGGATGGTAGGAAATTCCAGG - Intergenic
1180513349 22:16115791-16115813 GGGGGATGGTAGGAAATTCCAGG - Intergenic
1181033920 22:20160950-20160972 GGAGGCTGGAAGGAGGCCCCAGG + Intergenic
1181107318 22:20582860-20582882 GGGGCTGGGCAGGAAGCTACTGG - Exonic
1181509436 22:23382453-23382475 GGAGGCTGGAAGGAGGCCCCAGG - Intergenic
1182919413 22:34065564-34065586 AGGGGTTGCAAGGATGCTACTGG + Intergenic
1184186541 22:42868850-42868872 GGGGGTCAGAAGCAGGCTCCTGG - Intronic
1184242135 22:43216893-43216915 GGGGGTGGGAGGGAAGCTGTTGG - Intronic
1184531564 22:45059380-45059402 GGTGGTTGAAAGGCAGCTGCAGG + Intergenic
1184819637 22:46899940-46899962 GGGGGTTGGAGGGATGCTTACGG - Intronic
1185257766 22:49845542-49845564 GGGGGTAGGGCTGAAGCTCCAGG + Intergenic
950415621 3:12867509-12867531 GGGGCTAGGAAGGAAACACCAGG - Intronic
950786865 3:15444263-15444285 GGTGGCTGGAAGCAGGCTCCTGG + Intronic
951827980 3:26889662-26889684 AGGGATTTGAAGGAAGCTCCAGG - Intergenic
952336950 3:32411869-32411891 AGGAGTTCGAACGAAGCTCCAGG + Intronic
953536322 3:43779594-43779616 GGGGAGAGGAAGGAAGCACCAGG - Intergenic
954630321 3:52044510-52044532 GGGGCTTGGGATGAGGCTCCCGG - Intergenic
955838865 3:63089928-63089950 TGGGGGTGGAAGGCAGCTCTGGG + Intergenic
960264343 3:115603299-115603321 GGGGGTTGGAAAACAGCTCCTGG - Intergenic
961358448 3:126353060-126353082 GGGGGATGGAAGCAGGATCCAGG - Intronic
961380089 3:126491458-126491480 GGGGACTGCTAGGAAGCTCCAGG - Intronic
961574278 3:127822478-127822500 GGGAGCTGGAAGCAGGCTCCCGG - Exonic
961713965 3:128846412-128846434 GGGGCTAGGAAGGAAACACCAGG + Intergenic
961785240 3:129343515-129343537 GGGGCTAGGAAGGAAACACCAGG - Intergenic
963409380 3:144908502-144908524 GAGGGATGGAAGGGATCTCCAGG + Intergenic
963888244 3:150604066-150604088 AGGGGGTGGAAGGAAGGTCTGGG + Intronic
964423891 3:156532259-156532281 GTGGGTTGAAAGGATGTTCCTGG + Intronic
967390201 3:188947800-188947822 GGGGGTGGGGAGGAGGCTGCAGG - Intronic
968622300 4:1609281-1609303 GGGGGCTGGAAGGAGGCCCGAGG - Intergenic
969642261 4:8405910-8405932 GGGCCTTGGCAGGAAGCTCAGGG + Intronic
969676851 4:8619106-8619128 AGGGGTGGGAAGGACGTTCCAGG + Intronic
975047814 4:69826167-69826189 GAGGGAAGGAAGGAATCTCCAGG - Intronic
975834201 4:78404539-78404561 GGGGGTTGGAGGGAAGATGAAGG - Intronic
976226595 4:82799036-82799058 GGCGGGTGGAAGGTGGCTCCCGG + Intergenic
977248223 4:94659432-94659454 GGAGGTTGGAAGGAAGGTGAGGG - Intronic
977376738 4:96214728-96214750 GGGGGTAGTAAGGAATCTCACGG - Intergenic
980876633 4:138668218-138668240 GGGGGTTAGAAGAAATATCCAGG - Intergenic
985698913 5:1358790-1358812 GGGAGTGGGAAGGAAGCACGTGG + Intergenic
986012252 5:3726497-3726519 AGGGGTAGGAGGGAAGCACCTGG + Intergenic
989213226 5:38878347-38878369 GGGGGCTGGGGGGAAGCTTCTGG + Intronic
989314828 5:40066547-40066569 GGGGGGTGGAAAGTAGCTCATGG - Intergenic
989459856 5:41684815-41684837 AGGGGTTGGAAAAAAGCTGCTGG - Intergenic
991025857 5:62028912-62028934 GGGGCTGTGAAGGAAGCTGCAGG - Intergenic
991114845 5:62942761-62942783 GGGGGTGGGGTGGATGCTCCAGG + Intergenic
992205777 5:74429284-74429306 GGGGGTTTGGAGGAGGGTCCTGG - Intergenic
994589653 5:101758032-101758054 TGGGGTCCGAAGGAAGCTGCTGG + Intergenic
998386274 5:141758786-141758808 GGGGGAGGGGAGGAAGCACCGGG + Intergenic
998395418 5:141814843-141814865 GGGGGGTGGAAGGAAGTGCTGGG - Intergenic
998448428 5:142216272-142216294 GGGGCCTGGGAGGTAGCTCCGGG - Intergenic
999307530 5:150529845-150529867 GGGGCCTGGAAGGAGGGTCCTGG + Intronic
999591249 5:153148936-153148958 GTGGATTGAAAGGAAGCTCAAGG + Intergenic
999783741 5:154872579-154872601 GAGGATTGGAAGGCAGCACCAGG + Exonic
1000328116 5:160187523-160187545 GGGGGTTGGGGGGGAGCTCATGG + Intronic
1002092152 5:176811867-176811889 GGGTGTTGGAAGGGAGCACTGGG + Intronic
1002817551 6:693912-693934 GGGGGTTGGGGGGATGCTCGGGG + Intergenic
1004140501 6:13013653-13013675 GGGGGTAGGCAGGGCGCTCCTGG - Intronic
1006221584 6:32496276-32496298 GAGGGTGGGAAGGGATCTCCAGG - Intergenic
1006913631 6:37580346-37580368 GCGGGAAGGAAGAAAGCTCCAGG - Intergenic
1006934250 6:37706061-37706083 CGGGCTTGGAAGGAATCCCCAGG + Intergenic
1007229200 6:40336698-40336720 TGGGGGTGTAAGGATGCTCCTGG - Intergenic
1007769339 6:44180521-44180543 GGGGGTTGGAAGGAAGCTCCTGG + Intronic
1008627749 6:53334758-53334780 GGGAGTTGGAAGGAAAAACCAGG - Intronic
1009441058 6:63678900-63678922 AGGGGTTAGAAGGAACCTCAAGG - Intronic
1015897975 6:138035218-138035240 GGGGGCAGGGAGGATGCTCCAGG - Intergenic
1017881512 6:158565712-158565734 GGGGGTGGGAGGGGAGCTGCAGG + Intronic
1018093936 6:160368273-160368295 TGGGGTTAGAAGGAAGCTATGGG - Intronic
1019377308 7:699689-699711 AGGGGTGGGGAGGAAGTTCCAGG + Intronic
1019598280 7:1868528-1868550 GGGGTGGGGAAGGGAGCTCCTGG + Intronic
1019810975 7:3165001-3165023 CCTGCTTGGAAGGAAGCTCCAGG - Intronic
1020100319 7:5390677-5390699 AGGAGCTGGAAGGAAGCTCCTGG - Intronic
1020839362 7:13195651-13195673 GGGGCTTGGAGGGATGTTCCAGG + Intergenic
1022099202 7:27159164-27159186 GTAGGTAGGAAGGAAGCTCAGGG - Intergenic
1022630546 7:32080290-32080312 GGGGGTTGGAGGGAAGGTCAGGG - Intronic
1022973298 7:35536324-35536346 GGAGGTTGGAGGGGAGCCCCTGG - Intergenic
1023609260 7:41957283-41957305 GGGGGCTGGGAGGAAGCTGAGGG + Intergenic
1025997115 7:66534967-66534989 GTGGGTGGGAAGGAGGCTGCTGG - Intergenic
1027137924 7:75638254-75638276 GGGGGTTCGCAGGGAGCACCTGG - Intronic
1027892991 7:84001299-84001321 GGGGGTTGGGTGGAAGCAGCAGG - Intronic
1030706551 7:112698625-112698647 GGGGGTTGGGATGAAGCTCAGGG - Intergenic
1031449086 7:121891916-121891938 GGGAGCTGGAAGAAAGCTGCTGG - Intronic
1031586003 7:123533004-123533026 GGGGGTTGGGAGGTAGCGTCCGG + Intronic
1032033864 7:128506961-128506983 TGGGGCTGGAAGGTGGCTCCAGG + Intergenic
1033587567 7:142786036-142786058 GGAGGTGAGAAGGAAGCCCCCGG + Intergenic
1034564290 7:151900925-151900947 GGGGTTTGAAATGGAGCTCCAGG + Intergenic
1035572373 8:681161-681183 GGGGGTTTGACAGCAGCTCCAGG + Intronic
1035677067 8:1463450-1463472 GTGGGTTCGAAGGGAGTTCCTGG - Intergenic
1037170745 8:15888769-15888791 GAGGGTGGGATGGAAGCTTCAGG + Intergenic
1037888789 8:22610433-22610455 GGAGGTTGTAAGGCAGCACCAGG - Intronic
1038970706 8:32631309-32631331 GGGGGTTGGAAGGAGCCTTGAGG - Intronic
1039770149 8:40678003-40678025 GGGGGTGGGAAGCAAGCATCAGG + Intronic
1042872140 8:73408959-73408981 AGAGGATGGGAGGAAGCTCCTGG - Intergenic
1045462386 8:102436970-102436992 GGAGGTTGGGAGGCACCTCCTGG - Intergenic
1045480041 8:102584458-102584480 GTCCGTTGGAAGGAAGATCCAGG - Intergenic
1045748695 8:105455893-105455915 GGGGCTTGGAAGAAAGGTCTGGG + Intronic
1046848996 8:118952021-118952043 GGGGGTGTGCAGAAAGCTCCAGG + Exonic
1048280621 8:133102933-133102955 GGGAGTTGGAAAGCAGCACCTGG + Intronic
1048522661 8:135171152-135171174 GGGGGCTGGGTGGAGGCTCCCGG + Intergenic
1048578988 8:135715643-135715665 GGGTGCTGGAAGCAGGCTCCAGG - Intergenic
1049883985 9:15813-15835 GGGGGTGGGCAGAAAGCACCCGG + Intergenic
1051029467 9:12657660-12657682 TGGGGTTGGAAGGAAGTTCTGGG - Intergenic
1053157602 9:35791682-35791704 GGGGGGCGGGAGGAAGCGCCGGG + Intergenic
1053209045 9:36212107-36212129 TGAGGTTGGAAGGAATTTCCAGG + Intronic
1053708892 9:40784848-40784870 GGGGGATGGTAGGAAATTCCAGG + Intergenic
1054418802 9:64905645-64905667 GGGGGATGGTAGGAAATTCCAGG + Intergenic
1056303141 9:85262460-85262482 GGGGCTTGGCAGGAAGCTGTGGG - Intergenic
1056965927 9:91162902-91162924 GGGGGTGGGGAGCATGCTCCAGG - Intergenic
1057192797 9:93096618-93096640 GGGGGCTACAAGGCAGCTCCAGG + Intronic
1060728466 9:126021839-126021861 GGGTGCTGGGAGGAACCTCCAGG - Intergenic
1061506063 9:131032420-131032442 GGAGGAAGGAAGGAACCTCCAGG - Intronic
1061677011 9:132223238-132223260 GGGGGTTAGCTGGAAGCCCCAGG + Intronic
1189076492 X:37920885-37920907 GGGCCTGTGAAGGAAGCTCCAGG - Intronic
1190320402 X:49176451-49176473 GAGGGTTGGAAGGAAGAACACGG + Intronic
1190512302 X:51185669-51185691 AGGGGCTGGAAAGAAGCTTCAGG - Intergenic
1192232192 X:69273115-69273137 GGGGGTTTGAAGGAGGCTGAGGG - Intergenic
1200084310 X:153595887-153595909 GGAGCTTGGAAGGAAGTACCTGG - Intronic
1201989723 Y:20010243-20010265 GAGGGAGGGAAGGAATCTCCAGG + Intergenic
1202074903 Y:21027796-21027818 GAGGGATGGAAGGGATCTCCAGG + Intergenic