ID: 1007771094

View in Genome Browser
Species Human (GRCh38)
Location 6:44192897-44192919
Sequence TAGTCAACACACTCTTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007771094_1007771095 -10 Left 1007771094 6:44192897-44192919 CCTGCACAAGAGTGTGTTGACTA No data
Right 1007771095 6:44192910-44192932 GTGTTGACTAAAGCAACCAATGG No data
1007771094_1007771096 -7 Left 1007771094 6:44192897-44192919 CCTGCACAAGAGTGTGTTGACTA No data
Right 1007771096 6:44192913-44192935 TTGACTAAAGCAACCAATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007771094 Original CRISPR TAGTCAACACACTCTTGTGC AGG (reversed) Intergenic
No off target data available for this crispr