ID: 1007771094 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:44192897-44192919 |
| Sequence | TAGTCAACACACTCTTGTGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 109 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 100} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1007771094_1007771095 | -10 | Left | 1007771094 | 6:44192897-44192919 | CCTGCACAAGAGTGTGTTGACTA | 0: 1 1: 0 2: 0 3: 8 4: 100 |
||
| Right | 1007771095 | 6:44192910-44192932 | GTGTTGACTAAAGCAACCAATGG | No data | ||||
| 1007771094_1007771096 | -7 | Left | 1007771094 | 6:44192897-44192919 | CCTGCACAAGAGTGTGTTGACTA | 0: 1 1: 0 2: 0 3: 8 4: 100 |
||
| Right | 1007771096 | 6:44192913-44192935 | TTGACTAAAGCAACCAATGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1007771094 | Original CRISPR | TAGTCAACACACTCTTGTGC AGG (reversed) | Intergenic | ||