ID: 1007771096

View in Genome Browser
Species Human (GRCh38)
Location 6:44192913-44192935
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007771094_1007771096 -7 Left 1007771094 6:44192897-44192919 CCTGCACAAGAGTGTGTTGACTA 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1007771096 6:44192913-44192935 TTGACTAAAGCAACCAATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007771096 Original CRISPR TTGACTAAAGCAACCAATGG CGG Intergenic