ID: 1007777984

View in Genome Browser
Species Human (GRCh38)
Location 6:44234354-44234376
Sequence GGCTAACAGTCTTGGTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007777984_1007777989 26 Left 1007777984 6:44234354-44234376 CCAGAACACCAAGACTGTTAGCC No data
Right 1007777989 6:44234403-44234425 TGCTTCATTCTTTCTTTCATAGG No data
1007777984_1007777986 -9 Left 1007777984 6:44234354-44234376 CCAGAACACCAAGACTGTTAGCC No data
Right 1007777986 6:44234368-44234390 CTGTTAGCCAAGACTAAGAACGG No data
1007777984_1007777987 -8 Left 1007777984 6:44234354-44234376 CCAGAACACCAAGACTGTTAGCC No data
Right 1007777987 6:44234369-44234391 TGTTAGCCAAGACTAAGAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007777984 Original CRISPR GGCTAACAGTCTTGGTGTTC TGG (reversed) Intergenic
No off target data available for this crispr