ID: 1007779708

View in Genome Browser
Species Human (GRCh38)
Location 6:44245986-44246008
Sequence AGGGCAGCCGGAGCTCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007779708_1007779716 10 Left 1007779708 6:44245986-44246008 CCTCCAAGAGCTCCGGCTGCCCT No data
Right 1007779716 6:44246019-44246041 CCAGAGACTCCCTCCTTCCCAGG No data
1007779708_1007779718 19 Left 1007779708 6:44245986-44246008 CCTCCAAGAGCTCCGGCTGCCCT No data
Right 1007779718 6:44246028-44246050 CCCTCCTTCCCAGGTCCAAATGG No data
1007779708_1007779721 26 Left 1007779708 6:44245986-44246008 CCTCCAAGAGCTCCGGCTGCCCT No data
Right 1007779721 6:44246035-44246057 TCCCAGGTCCAAATGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007779708 Original CRISPR AGGGCAGCCGGAGCTCTTGG AGG (reversed) Intergenic