ID: 1007779709

View in Genome Browser
Species Human (GRCh38)
Location 6:44245989-44246011
Sequence TGCAGGGCAGCCGGAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007779709_1007779716 7 Left 1007779709 6:44245989-44246011 CCAAGAGCTCCGGCTGCCCTGCA No data
Right 1007779716 6:44246019-44246041 CCAGAGACTCCCTCCTTCCCAGG No data
1007779709_1007779721 23 Left 1007779709 6:44245989-44246011 CCAAGAGCTCCGGCTGCCCTGCA No data
Right 1007779721 6:44246035-44246057 TCCCAGGTCCAAATGGCTGCAGG No data
1007779709_1007779718 16 Left 1007779709 6:44245989-44246011 CCAAGAGCTCCGGCTGCCCTGCA No data
Right 1007779718 6:44246028-44246050 CCCTCCTTCCCAGGTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007779709 Original CRISPR TGCAGGGCAGCCGGAGCTCT TGG (reversed) Intergenic