ID: 1007779711

View in Genome Browser
Species Human (GRCh38)
Location 6:44245998-44246020
Sequence GGGAACCAGTGCAGGGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007779711_1007779718 7 Left 1007779711 6:44245998-44246020 CCGGCTGCCCTGCACTGGTTCCC No data
Right 1007779718 6:44246028-44246050 CCCTCCTTCCCAGGTCCAAATGG No data
1007779711_1007779716 -2 Left 1007779711 6:44245998-44246020 CCGGCTGCCCTGCACTGGTTCCC No data
Right 1007779716 6:44246019-44246041 CCAGAGACTCCCTCCTTCCCAGG No data
1007779711_1007779725 24 Left 1007779711 6:44245998-44246020 CCGGCTGCCCTGCACTGGTTCCC No data
Right 1007779725 6:44246045-44246067 AAATGGCTGCAGGAGCGAAGTGG No data
1007779711_1007779726 25 Left 1007779711 6:44245998-44246020 CCGGCTGCCCTGCACTGGTTCCC No data
Right 1007779726 6:44246046-44246068 AATGGCTGCAGGAGCGAAGTGGG No data
1007779711_1007779727 28 Left 1007779711 6:44245998-44246020 CCGGCTGCCCTGCACTGGTTCCC No data
Right 1007779727 6:44246049-44246071 GGCTGCAGGAGCGAAGTGGGCGG No data
1007779711_1007779721 14 Left 1007779711 6:44245998-44246020 CCGGCTGCCCTGCACTGGTTCCC No data
Right 1007779721 6:44246035-44246057 TCCCAGGTCCAAATGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007779711 Original CRISPR GGGAACCAGTGCAGGGCAGC CGG (reversed) Intergenic