ID: 1007779712

View in Genome Browser
Species Human (GRCh38)
Location 6:44246005-44246027
Sequence AGTCTCTGGGAACCAGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007779712_1007779726 18 Left 1007779712 6:44246005-44246027 CCCTGCACTGGTTCCCAGAGACT No data
Right 1007779726 6:44246046-44246068 AATGGCTGCAGGAGCGAAGTGGG No data
1007779712_1007779727 21 Left 1007779712 6:44246005-44246027 CCCTGCACTGGTTCCCAGAGACT No data
Right 1007779727 6:44246049-44246071 GGCTGCAGGAGCGAAGTGGGCGG No data
1007779712_1007779718 0 Left 1007779712 6:44246005-44246027 CCCTGCACTGGTTCCCAGAGACT No data
Right 1007779718 6:44246028-44246050 CCCTCCTTCCCAGGTCCAAATGG No data
1007779712_1007779716 -9 Left 1007779712 6:44246005-44246027 CCCTGCACTGGTTCCCAGAGACT No data
Right 1007779716 6:44246019-44246041 CCAGAGACTCCCTCCTTCCCAGG No data
1007779712_1007779721 7 Left 1007779712 6:44246005-44246027 CCCTGCACTGGTTCCCAGAGACT No data
Right 1007779721 6:44246035-44246057 TCCCAGGTCCAAATGGCTGCAGG No data
1007779712_1007779725 17 Left 1007779712 6:44246005-44246027 CCCTGCACTGGTTCCCAGAGACT No data
Right 1007779725 6:44246045-44246067 AAATGGCTGCAGGAGCGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007779712 Original CRISPR AGTCTCTGGGAACCAGTGCA GGG (reversed) Intergenic