ID: 1007779713

View in Genome Browser
Species Human (GRCh38)
Location 6:44246006-44246028
Sequence GAGTCTCTGGGAACCAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007779713_1007779716 -10 Left 1007779713 6:44246006-44246028 CCTGCACTGGTTCCCAGAGACTC No data
Right 1007779716 6:44246019-44246041 CCAGAGACTCCCTCCTTCCCAGG No data
1007779713_1007779725 16 Left 1007779713 6:44246006-44246028 CCTGCACTGGTTCCCAGAGACTC No data
Right 1007779725 6:44246045-44246067 AAATGGCTGCAGGAGCGAAGTGG No data
1007779713_1007779721 6 Left 1007779713 6:44246006-44246028 CCTGCACTGGTTCCCAGAGACTC No data
Right 1007779721 6:44246035-44246057 TCCCAGGTCCAAATGGCTGCAGG No data
1007779713_1007779727 20 Left 1007779713 6:44246006-44246028 CCTGCACTGGTTCCCAGAGACTC No data
Right 1007779727 6:44246049-44246071 GGCTGCAGGAGCGAAGTGGGCGG No data
1007779713_1007779726 17 Left 1007779713 6:44246006-44246028 CCTGCACTGGTTCCCAGAGACTC No data
Right 1007779726 6:44246046-44246068 AATGGCTGCAGGAGCGAAGTGGG No data
1007779713_1007779718 -1 Left 1007779713 6:44246006-44246028 CCTGCACTGGTTCCCAGAGACTC No data
Right 1007779718 6:44246028-44246050 CCCTCCTTCCCAGGTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007779713 Original CRISPR GAGTCTCTGGGAACCAGTGC AGG (reversed) Intergenic