ID: 1007779718

View in Genome Browser
Species Human (GRCh38)
Location 6:44246028-44246050
Sequence CCCTCCTTCCCAGGTCCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007779713_1007779718 -1 Left 1007779713 6:44246006-44246028 CCTGCACTGGTTCCCAGAGACTC No data
Right 1007779718 6:44246028-44246050 CCCTCCTTCCCAGGTCCAAATGG No data
1007779709_1007779718 16 Left 1007779709 6:44245989-44246011 CCAAGAGCTCCGGCTGCCCTGCA No data
Right 1007779718 6:44246028-44246050 CCCTCCTTCCCAGGTCCAAATGG No data
1007779708_1007779718 19 Left 1007779708 6:44245986-44246008 CCTCCAAGAGCTCCGGCTGCCCT No data
Right 1007779718 6:44246028-44246050 CCCTCCTTCCCAGGTCCAAATGG No data
1007779712_1007779718 0 Left 1007779712 6:44246005-44246027 CCCTGCACTGGTTCCCAGAGACT No data
Right 1007779718 6:44246028-44246050 CCCTCCTTCCCAGGTCCAAATGG No data
1007779711_1007779718 7 Left 1007779711 6:44245998-44246020 CCGGCTGCCCTGCACTGGTTCCC No data
Right 1007779718 6:44246028-44246050 CCCTCCTTCCCAGGTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007779718 Original CRISPR CCCTCCTTCCCAGGTCCAAA TGG Intergenic