ID: 1007779726

View in Genome Browser
Species Human (GRCh38)
Location 6:44246046-44246068
Sequence AATGGCTGCAGGAGCGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007779720_1007779726 -9 Left 1007779720 6:44246032-44246054 CCTTCCCAGGTCCAAATGGCTGC No data
Right 1007779726 6:44246046-44246068 AATGGCTGCAGGAGCGAAGTGGG No data
1007779712_1007779726 18 Left 1007779712 6:44246005-44246027 CCCTGCACTGGTTCCCAGAGACT No data
Right 1007779726 6:44246046-44246068 AATGGCTGCAGGAGCGAAGTGGG No data
1007779717_1007779726 -5 Left 1007779717 6:44246028-44246050 CCCTCCTTCCCAGGTCCAAATGG No data
Right 1007779726 6:44246046-44246068 AATGGCTGCAGGAGCGAAGTGGG No data
1007779711_1007779726 25 Left 1007779711 6:44245998-44246020 CCGGCTGCCCTGCACTGGTTCCC No data
Right 1007779726 6:44246046-44246068 AATGGCTGCAGGAGCGAAGTGGG No data
1007779719_1007779726 -6 Left 1007779719 6:44246029-44246051 CCTCCTTCCCAGGTCCAAATGGC No data
Right 1007779726 6:44246046-44246068 AATGGCTGCAGGAGCGAAGTGGG No data
1007779713_1007779726 17 Left 1007779713 6:44246006-44246028 CCTGCACTGGTTCCCAGAGACTC No data
Right 1007779726 6:44246046-44246068 AATGGCTGCAGGAGCGAAGTGGG No data
1007779715_1007779726 4 Left 1007779715 6:44246019-44246041 CCAGAGACTCCCTCCTTCCCAGG No data
Right 1007779726 6:44246046-44246068 AATGGCTGCAGGAGCGAAGTGGG No data
1007779714_1007779726 5 Left 1007779714 6:44246018-44246040 CCCAGAGACTCCCTCCTTCCCAG No data
Right 1007779726 6:44246046-44246068 AATGGCTGCAGGAGCGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007779726 Original CRISPR AATGGCTGCAGGAGCGAAGT GGG Intergenic