ID: 1007779727

View in Genome Browser
Species Human (GRCh38)
Location 6:44246049-44246071
Sequence GGCTGCAGGAGCGAAGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007779722_1007779727 -10 Left 1007779722 6:44246036-44246058 CCCAGGTCCAAATGGCTGCAGGA No data
Right 1007779727 6:44246049-44246071 GGCTGCAGGAGCGAAGTGGGCGG No data
1007779715_1007779727 7 Left 1007779715 6:44246019-44246041 CCAGAGACTCCCTCCTTCCCAGG No data
Right 1007779727 6:44246049-44246071 GGCTGCAGGAGCGAAGTGGGCGG No data
1007779711_1007779727 28 Left 1007779711 6:44245998-44246020 CCGGCTGCCCTGCACTGGTTCCC No data
Right 1007779727 6:44246049-44246071 GGCTGCAGGAGCGAAGTGGGCGG No data
1007779712_1007779727 21 Left 1007779712 6:44246005-44246027 CCCTGCACTGGTTCCCAGAGACT No data
Right 1007779727 6:44246049-44246071 GGCTGCAGGAGCGAAGTGGGCGG No data
1007779719_1007779727 -3 Left 1007779719 6:44246029-44246051 CCTCCTTCCCAGGTCCAAATGGC No data
Right 1007779727 6:44246049-44246071 GGCTGCAGGAGCGAAGTGGGCGG No data
1007779714_1007779727 8 Left 1007779714 6:44246018-44246040 CCCAGAGACTCCCTCCTTCCCAG No data
Right 1007779727 6:44246049-44246071 GGCTGCAGGAGCGAAGTGGGCGG No data
1007779713_1007779727 20 Left 1007779713 6:44246006-44246028 CCTGCACTGGTTCCCAGAGACTC No data
Right 1007779727 6:44246049-44246071 GGCTGCAGGAGCGAAGTGGGCGG No data
1007779717_1007779727 -2 Left 1007779717 6:44246028-44246050 CCCTCCTTCCCAGGTCCAAATGG No data
Right 1007779727 6:44246049-44246071 GGCTGCAGGAGCGAAGTGGGCGG No data
1007779720_1007779727 -6 Left 1007779720 6:44246032-44246054 CCTTCCCAGGTCCAAATGGCTGC No data
Right 1007779727 6:44246049-44246071 GGCTGCAGGAGCGAAGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007779727 Original CRISPR GGCTGCAGGAGCGAAGTGGG CGG Intergenic