ID: 1007784598

View in Genome Browser
Species Human (GRCh38)
Location 6:44272399-44272421
Sequence CAGAACATGGGGAATGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007784598 Original CRISPR CAGAACATGGGGAATGAGAC TGG Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900695508 1:4007016-4007038 CAGAAAAAGGGTAGTGAGACAGG + Intergenic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
901770435 1:11527632-11527654 GAGAACATTGGCAAAGAGACGGG + Intronic
901842669 1:11963923-11963945 CAGAACCTGGGGTATCAGGCTGG - Intronic
902394783 1:16126678-16126700 CAGACCACGGTGAAGGAGACAGG + Intronic
902546799 1:17195334-17195356 CAGAGCATGGGGACAGCGACAGG - Intergenic
903064309 1:20690187-20690209 GAGAACCTGCGGAAGGAGACAGG - Exonic
903144384 1:21361338-21361360 CAGAACATGGGATATCAGACAGG + Intergenic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903857483 1:26345494-26345516 CAGAACAAGGGGAGTGAGCCGGG + Exonic
904027630 1:27514354-27514376 CAGAACATGTGGAAGGAGCTAGG - Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
906606734 1:47178010-47178032 GAGAAAAAGGGGAATGAGACAGG - Intergenic
907737100 1:57124946-57124968 AAGAACATGAGGCATGAGGCCGG - Intronic
910669550 1:89759321-89759343 CAGAACACAAGGAAGGAGACTGG + Intronic
912210896 1:107555839-107555861 CAGCAAATGGGCAAGGAGACAGG + Intergenic
912262423 1:108122624-108122646 GAAAACATGGGGAATGGGATGGG - Intergenic
912913641 1:113789288-113789310 CTGAACATGTGGAAGCAGACAGG + Intronic
914914006 1:151807220-151807242 AGGAATATGGGAAATGAGACAGG + Exonic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916723498 1:167503022-167503044 AAGAACATGGGAAGTGAGGCAGG + Intronic
918148934 1:181781591-181781613 CAGAACATGGGGAGGAAGCCAGG + Intronic
918253548 1:182726349-182726371 CAGAGCATGGAGATTGAGACTGG - Intergenic
922146522 1:222950748-222950770 CAGCACACGTGGAATGTGACTGG - Intronic
922436617 1:225613911-225613933 CACAACCTGGGGCATGAGATTGG - Intronic
1063720423 10:8574868-8574890 CAGAACAGGAGGGGTGAGACAGG + Intergenic
1064257952 10:13760683-13760705 CAAAGCATGGGGAAACAGACAGG + Intronic
1064804009 10:19110054-19110076 TAGAGCATGGGGACTCAGACTGG - Intronic
1066012942 10:31210908-31210930 CAGGGGATGGGAAATGAGACAGG - Intergenic
1067460298 10:46453235-46453257 AAGAATATGGGGAAGGAGACAGG - Intergenic
1067626892 10:47931368-47931390 AAGAATATGGGGAAGGAGACAGG + Intergenic
1069071178 10:63991908-63991930 CAGTACATGGGGATTGGGATGGG + Intergenic
1070004955 10:72414895-72414917 CAGAACTTGGGCAATTAGATTGG - Intronic
1070210714 10:74317709-74317731 CAGTACATTGAGAATGAGAATGG + Intronic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072685077 10:97531837-97531859 CGGAGCATGAGGAATGTGACAGG + Intronic
1077090179 11:774885-774907 CAGGAAATGGGGACTGGGACAGG + Intronic
1077845814 11:6023621-6023643 CAGAACATGAGAAGAGAGACAGG - Intergenic
1079152408 11:17912170-17912192 GAGAAGATGGTGAAGGAGACAGG + Intronic
1082134883 11:48536393-48536415 CAGTACTTGAGGAATGAGAAAGG - Intergenic
1082720203 11:56665013-56665035 AAAAACATGGAGAATGAGGCTGG + Intergenic
1083119377 11:60496090-60496112 TAAATCAAGGGGAATGAGACAGG + Intronic
1083276581 11:61600345-61600367 CAGAACCTGGAGAATGAGAAGGG - Intergenic
1083372365 11:62192501-62192523 GAGGACATGGGGAGTGAGCCTGG + Intronic
1083378253 11:62243730-62243752 GAGGACATGGGGAGTGAGCCTGG + Intronic
1084454606 11:69261219-69261241 CAGGAGATGGGGCAGGAGACTGG - Intergenic
1084462348 11:69302961-69302983 CAGAACCTTGGGAAAGAGAAAGG + Intronic
1086673260 11:89572706-89572728 AAGAAGATGGGGAAAAAGACGGG - Intergenic
1090466445 11:126938924-126938946 CAGAACAAGTAGGATGAGACAGG + Intronic
1091127775 11:133117170-133117192 CAGAACATTTGAAATGACACAGG - Intronic
1091646757 12:2278041-2278063 CAGATCATGAGGACTGAGATTGG - Intronic
1091994768 12:4984774-4984796 TAGAACATGGGGAGAGACACAGG - Intergenic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1095581177 12:43801384-43801406 TAGAACATGGGGAATTAAAGAGG + Intronic
1097611650 12:61830589-61830611 CAGAAAAATGGGAATGAGATGGG + Intronic
1099463614 12:82955199-82955221 CACAACTTGGGGAATGTAACTGG - Intronic
1101797671 12:107990739-107990761 CAGGACATGGGGACTGAGTGAGG + Intergenic
1103674293 12:122643546-122643568 CAGCAGATGGGGGATGAGCCTGG + Intergenic
1103941946 12:124506030-124506052 CAGAATGTGGGGAATGATAGAGG - Intronic
1106142025 13:27019596-27019618 CAGAATTTGGGGAATGGGACAGG - Intergenic
1109091414 13:58051366-58051388 CAGAAAATTGGTAATGAGAGTGG + Intergenic
1110323001 13:74181384-74181406 CAGAAAATTGAGAATGAGGCTGG + Intergenic
1111330297 13:86757400-86757422 CAGAATGTGGGGACTGAGTCAGG + Intergenic
1112097475 13:96150660-96150682 AATAACATTGGAAATGAGACTGG + Intronic
1112308340 13:98295553-98295575 AAGAACATGGGGGAGGAGAGGGG - Intronic
1112533425 13:100226693-100226715 CAGAAGATGAGTAATGACACAGG + Intronic
1113915141 13:113865980-113866002 GAGAATATGAGGAATGAGAGTGG - Intergenic
1115149343 14:30266295-30266317 CAGAACATGGGCTTTGGGACAGG - Intergenic
1115367238 14:32572001-32572023 CAGAAAATAGTGAATGAGAAGGG + Intronic
1116867438 14:50042274-50042296 CAGAGCATGGAGAATTACACAGG - Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1118322466 14:64761380-64761402 CTGAACAGGGGGAAAGAGCCAGG + Intronic
1118324935 14:64774346-64774368 CAGGAGATGGGGATTGAGCCAGG - Intronic
1118835123 14:69472437-69472459 CAGAACATGGGGGTGGGGACAGG - Intergenic
1120508693 14:85385615-85385637 CAGAAGTTGGGGGATGAGAATGG + Intergenic
1121111929 14:91318452-91318474 CAGAAGATGTGGCATGAGACGGG + Intronic
1121552791 14:94814983-94815005 CAGAACCTGGAGAGAGAGACAGG - Intergenic
1123765851 15:23477826-23477848 CAGAACATGGGGCTTGAGAAGGG + Intergenic
1125068924 15:35528537-35528559 CTGAACATGGGGAATGCCAAGGG - Intronic
1125152117 15:36544777-36544799 CAGAACATCTGTAATGAGAATGG + Intergenic
1125193631 15:37021488-37021510 GATAACATTGGAAATGAGACAGG - Intronic
1125549913 15:40537466-40537488 CAGAGCAAGGGGTAGGAGACAGG - Intronic
1125558406 15:40606159-40606181 CAGACCATGTGGGATGAGAGCGG + Intronic
1127366452 15:58295041-58295063 CAGAGCATGGGGCATCAGAGAGG + Intronic
1129326556 15:74802976-74802998 CACAGAATGGGGAATGAGGCTGG - Exonic
1130414569 15:83680216-83680238 CAGAACATATGGAATGTGAAAGG + Intronic
1130857775 15:87856509-87856531 CAGAACATGGGGGAAAAGAGAGG + Intergenic
1133867740 16:9659756-9659778 CATGAGAAGGGGAATGAGACAGG - Intergenic
1135377688 16:21963438-21963460 CAAAACATTGGGAAGGAAACAGG - Intronic
1135413588 16:22252597-22252619 CAGACCACAGGGACTGAGACTGG + Intronic
1136146162 16:28317779-28317801 CAGCCCAGGGGGAAAGAGACTGG + Intronic
1136415660 16:30101953-30101975 GAGAAGATGGGGATTGCGACTGG - Intergenic
1136630106 16:31484997-31485019 CAGGAAAGGGGGAATGAGACTGG + Intronic
1138803072 16:60058566-60058588 CCAATCATGGGGAATGAGAAGGG + Intergenic
1144877714 17:18411095-18411117 CAGAAGGTGGGGAAGAAGACTGG - Intergenic
1145154515 17:20533308-20533330 CAGAAGGTGGGGAAGAAGACTGG + Intergenic
1145313398 17:21713070-21713092 GAGAACATGGGGCAGGTGACTGG + Intergenic
1146195932 17:30812836-30812858 GAGGACAAGGGGAAAGAGACAGG + Intronic
1150254994 17:63737529-63737551 CAGAAGATGGGAAATGGAACAGG + Intronic
1151171519 17:72250326-72250348 CAGAAGATGGAGTCTGAGACTGG - Intergenic
1151520106 17:74622237-74622259 CTGAGGATGGGGAATGAGATAGG + Intronic
1152886471 17:82853942-82853964 AAGAAGATGTGGAATGGGACTGG - Intronic
1160237764 18:77099508-77099530 CAGGAAATGAGGAAAGAGACAGG - Intronic
1161684251 19:5695245-5695267 CAGCACATGAGGAAGGGGACTGG + Intronic
1164837762 19:31368977-31368999 CTGAACACTGGGAATGAGGCTGG - Intergenic
1165550925 19:36585008-36585030 CAGAAAGTGGGGAAAGAGATGGG + Intronic
1165637254 19:37351290-37351312 CACAATATGGGGAATGAAAGAGG - Intronic
1166388936 19:42398058-42398080 CAGAACTGGAGGAATGAGACTGG + Intergenic
1166546773 19:43638994-43639016 CAGAGAAGGGGGAAAGAGACAGG + Intronic
1167678390 19:50903897-50903919 CAGAACATGTGGTATTTGACTGG - Intergenic
927085333 2:19669639-19669661 CAGAACACGGGAACTGAGCCTGG - Intergenic
927903883 2:26843635-26843657 CACAAACAGGGGAATGAGACTGG - Intergenic
928053819 2:28030077-28030099 TAAAAAAGGGGGAATGAGACAGG - Intronic
928134625 2:28679010-28679032 AAGAGCATGGGGAATGTGAATGG - Intergenic
928401678 2:30983469-30983491 CATTACCTGGGGAATGAGGCAGG - Intronic
930469570 2:51795290-51795312 GAGAACAGTGGGAGTGAGACTGG + Intergenic
933139468 2:78776321-78776343 AAGAACACGTGGAAAGAGACTGG + Intergenic
933185291 2:79271456-79271478 CAGAAGTTGGGGAATCAGAGTGG + Intronic
933230287 2:79799203-79799225 AAGAAGAGGGGGAATGAGGCTGG - Intronic
933318578 2:80744190-80744212 CAGAATATGGGCTGTGAGACGGG + Intergenic
933806136 2:85999033-85999055 TTTAACATGGGGAAGGAGACAGG + Intergenic
934151893 2:89154931-89154953 CAGAATAACGGGAATGAGCCTGG - Intergenic
934215367 2:90026976-90026998 CAGAATAACGGGAATGAGCCTGG + Intergenic
934565271 2:95336201-95336223 CAGAAAATGGGAAGAGAGACTGG - Intronic
935736552 2:106111121-106111143 CAGGACAGGGAGAATGAGAGTGG + Intronic
936518370 2:113196808-113196830 CAGAACATGGGGTGTGTGAAAGG + Intronic
937735116 2:125278675-125278697 CAGAAGCTGGGGAATAACACAGG + Intergenic
938427022 2:131201282-131201304 CAGAACAGTGGGCATGAGCCTGG + Intronic
938623166 2:133078622-133078644 CAAGACAAGGAGAATGAGACAGG + Intronic
939168655 2:138667655-138667677 CAGAATATGGGGTAGGAGATTGG + Intergenic
939786661 2:146522024-146522046 CAGAACTTGGGGAAAAAGAGAGG - Intergenic
939973350 2:148687477-148687499 CAGAAAATGTGGCATGAGAACGG - Intronic
940754246 2:157663518-157663540 CAGACTACGGGGAAGGAGACTGG + Intergenic
941316292 2:163996994-163997016 TAGAACATGTTGAATGATACTGG + Intergenic
942552805 2:177137362-177137384 CAGAAGATGGGGAAAGGGGCTGG - Intergenic
943023091 2:182598620-182598642 TAGAACATGGGAAATGAGAAAGG - Intergenic
943580338 2:189676238-189676260 CAGAACATGGTTAATGATAAAGG + Intronic
944949312 2:204728924-204728946 TAGAACATGGTGGATGAGAGAGG + Intronic
945221644 2:207489909-207489931 CAGAACTTGGGGACAGGGACGGG - Intergenic
945307733 2:208274702-208274724 CAGAAGATGGGGAGTGGGAGAGG + Intronic
946388906 2:219403942-219403964 AAGAACTTGGGAAATGAGGCTGG + Intergenic
1169065234 20:2691495-2691517 CAGGAGATGGAGAAAGAGACTGG + Intergenic
1170353553 20:15468405-15468427 CAGAGCATGAGGAATGGAACAGG - Intronic
1170433510 20:16298845-16298867 CAGAACATGAGGAATTCAACAGG + Intronic
1173551931 20:43938468-43938490 CAGGACATGGGGCAGGAGCCAGG - Intronic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1175175121 20:57106885-57106907 CAGAACATGGAGGAAGAGAGAGG - Intergenic
1175547220 20:59786156-59786178 CAGAAGCTGGGGAATGAGCAGGG - Intronic
1175662001 20:60821391-60821413 CAGTAGATGGGGCATGAGAAAGG + Intergenic
1177933440 21:27314995-27315017 CAGGACATGGAAAAGGAGACAGG - Intergenic
1182871982 22:33655692-33655714 CAGGACCTGGGGATGGAGACTGG - Intronic
1183742266 22:39675373-39675395 CAGAGCATGGGGAAGGGGAGAGG - Intronic
950736362 3:15011880-15011902 CATGACATTGGGAAGGAGACAGG - Intronic
951478737 3:23136364-23136386 CAGAAAATGGGGTATAACACAGG - Intergenic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
953703613 3:45215133-45215155 CAGAACAAGGGGATTGGGGCAGG - Intergenic
954351358 3:50046743-50046765 CAGAAGCTGGTGAATGAAACAGG + Intronic
954504814 3:51059744-51059766 CAGAATATGGGTAATGATACAGG - Intronic
955070294 3:55567324-55567346 CAGAATGTTGGGAAAGAGACAGG + Intronic
955139011 3:56250312-56250334 CACAACATGAGGCAAGAGACAGG + Intronic
955756819 3:62233345-62233367 GAGAGCATGGGGAAGGAGAGGGG - Intronic
956236878 3:67082396-67082418 GAGGACATGGGGAGTGAGTCAGG + Intergenic
958594810 3:96209024-96209046 CAGAATATGGGAAAAGAGAAGGG + Intergenic
958685519 3:97387749-97387771 CAGAAAATTGGTAATGAGAGTGG - Intronic
959919213 3:111852130-111852152 CAGAACATGAGGAATGTTAAAGG - Intronic
960938789 3:122920222-122920244 AGAAACATGGGGAATGGGACTGG - Intronic
961006663 3:123410152-123410174 CAGAACTAGGAGAATGAGAAAGG + Intronic
962082584 3:132156286-132156308 CAGAACATGGTGAATATGAAGGG - Intronic
962626993 3:137235648-137235670 GAGAACATGGGGAAGGAGTTGGG + Intergenic
963749977 3:149167110-149167132 CAGAACATGGACACTGAGGCCGG - Exonic
964020910 3:152009424-152009446 CAGAAAGTGATGAATGAGACAGG - Intergenic
964345697 3:155752520-155752542 CAGAAAATGAGGAAAGACACTGG + Intergenic
966714636 3:183002822-183002844 CAGATCATGGGGAATGAATAGGG - Intergenic
967531600 3:190554132-190554154 CAGAACATGGGGTTTGAGAAAGG - Intronic
968077620 3:195825127-195825149 GAGTTCATGGGGAATGAGAGAGG + Intergenic
969298566 4:6283773-6283795 CAGACCATGAGGACTGAGAGTGG + Intronic
970298773 4:14659849-14659871 CAGAACAAGAGGAATGACAGAGG + Intergenic
971329952 4:25674134-25674156 AAGACAATGGGGAATGAAACTGG + Intronic
975984556 4:80190301-80190323 AAGAACATGGGAAATGTGGCGGG + Intronic
976441544 4:85081683-85081705 CTGATCATGGGGAATGAAAGAGG - Intergenic
977444333 4:97110176-97110198 CAGAAGCTGGAGAATGAGAAAGG - Intergenic
977786246 4:101038092-101038114 CATAACATGGGGCATGAACCTGG + Intronic
977832903 4:101615293-101615315 CAGAAAATGTGAAAAGAGACTGG - Intronic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
980806014 4:137814404-137814426 ATGAACATGGGGAATGGGAGGGG + Intergenic
980952939 4:139399754-139399776 CAGAATCTGAGAAATGAGACTGG + Intronic
981391059 4:144192457-144192479 CAGAACATGATAAAGGAGACTGG - Intergenic
982029098 4:151281231-151281253 GAGAGCCTGGGGAATGAGACTGG + Intronic
982273158 4:153612188-153612210 AAGAAGATGGGGAATGTGAGTGG + Intronic
982686587 4:158497520-158497542 GAGAACATGGAGAAAGATACAGG - Intronic
983493666 4:168418362-168418384 TAAAACATGGGTAATGAGGCCGG - Intronic
983977259 4:173950559-173950581 AAGAATATGGGAAATGAGGCCGG - Intergenic
984483261 4:180333266-180333288 CAGGACATAGAGAATGAGAATGG + Intergenic
985182380 4:187279454-187279476 CAGAGCATCTGGAAGGAGACAGG + Intergenic
985606416 5:860507-860529 CAGCACATGGGGACTGAGACTGG - Intronic
987303819 5:16619151-16619173 GAGAACATGGGGCAGGAGAGAGG + Intergenic
990927069 5:61038041-61038063 CTGAATATGGGTGATGAGACGGG + Intronic
990987721 5:61656093-61656115 CAGAACGTGAGGAATGATGCCGG - Intronic
997717174 5:136051016-136051038 CACAAAATGGGGAATGAGGGCGG + Intronic
1000692127 5:164337152-164337174 CAGTACATGAGTAATGGGACAGG + Intergenic
1002186233 5:177456080-177456102 CCGAACAAGGGGATGGAGACCGG - Exonic
1003412137 6:5875011-5875033 TAGAACAAGAGGAATGAGAATGG + Intergenic
1004885352 6:20045971-20045993 AAGAACAAGGGGGATGAAACTGG + Intergenic
1006267447 6:32937060-32937082 CTGAAAATGGGGACTGAGTCTGG - Intronic
1006592890 6:35171081-35171103 CGGAACATGGGGTGTGAGAGGGG + Intergenic
1007784598 6:44272399-44272421 CAGAACATGGGGAATGAGACTGG + Intronic
1009320941 6:62287062-62287084 CAGTACCTGGTGAAAGAGACTGG - Intergenic
1010370679 6:75103476-75103498 CAGAACATGGGGAAGCAGAGGGG - Intronic
1011101957 6:83732010-83732032 GAAAACAAGGGGAAAGAGACAGG + Intergenic
1012694146 6:102356017-102356039 CAGAACATGGGGCTTGAGAAGGG - Intergenic
1013068701 6:106708652-106708674 CAGAGGATGAGGAATGAGAATGG - Intergenic
1014416879 6:121194503-121194525 CAGATCTTGGAGAATGACACTGG + Intronic
1015518264 6:134106164-134106186 CAGAACCTTGGCAATGAGAATGG - Intergenic
1015858663 6:137652745-137652767 CAGAACATAGGGCTTGAGAAGGG + Intergenic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1016910164 6:149190778-149190800 GAGCACAGGGGGATTGAGACTGG - Intergenic
1017329718 6:153182207-153182229 CATACCCTGGGGAATGAGCCTGG + Intergenic
1022789100 7:33669014-33669036 AAGAGCATGGGCAAAGAGACAGG + Intergenic
1024548189 7:50539525-50539547 GAGAACAGAAGGAATGAGACAGG + Intronic
1024999952 7:55307446-55307468 CAGAAGCTGGGAAATGAGACTGG + Intergenic
1025952632 7:66157547-66157569 CAGCACTTGGAGACTGAGACAGG + Intergenic
1026161774 7:67875769-67875791 CATACCATCGGGAATGTGACAGG - Intergenic
1028572999 7:92313063-92313085 CAGTAAATGGTGAATGTGACAGG + Intronic
1028689620 7:93636988-93637010 AAGAACATGGGCAATGTAACAGG + Intronic
1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG + Exonic
1030570156 7:111212885-111212907 CAGAGCACATGGAATGAGACCGG - Intronic
1030924289 7:115432043-115432065 CAGAGGACGGGAAATGAGACAGG + Intergenic
1031083947 7:117283864-117283886 CAGAAGATGGAAAATGAGAGAGG + Intronic
1031216672 7:118901390-118901412 CAGAAAATGGGGAATGAAGGTGG - Intergenic
1031799440 7:126223780-126223802 GAGCACAGTGGGAATGAGACTGG - Intergenic
1032513697 7:132491833-132491855 AAGGAGATGGGGAAGGAGACAGG + Intronic
1033142108 7:138836847-138836869 CTGAACACAGGGAATGTGACTGG + Intronic
1033232948 7:139616031-139616053 CAGACCATGGGGAATGTGGAGGG - Intronic
1036451368 8:8870802-8870824 CAGAGCATGGGGCATGGGAGGGG - Intronic
1037743282 8:21624003-21624025 TGGATCATGGGGAATCAGACAGG + Intergenic
1038493075 8:27983713-27983735 CAGCACATGGGCCATGAGAGTGG + Intronic
1043499207 8:80836444-80836466 TAGAATATGGGGAATGAGGAGGG - Intronic
1044426901 8:92062608-92062630 CAGAACAGGAGGCATGAGCCCGG - Intronic
1045685288 8:104705187-104705209 CATATGATGGGGGATGAGACTGG - Intronic
1047020939 8:120774535-120774557 CAGAATGTGGTGAATGAGAGAGG + Intronic
1048018161 8:130515748-130515770 CAGAACTGGAGAAATGAGACTGG + Intergenic
1048206556 8:132420133-132420155 CAGAACATGGGAGATGGGAGAGG + Intronic
1049167322 8:141134567-141134589 CAAAACATGGGAAATCCGACTGG - Intronic
1049387269 8:142349649-142349671 CAGAATATCAGGAATGAGAAAGG + Intronic
1050624399 9:7487634-7487656 GAGAAGGTGGAGAATGAGACTGG + Intergenic
1056811108 9:89764522-89764544 CATAACAAGGAGAGTGAGACAGG - Intergenic
1057720104 9:97525475-97525497 CAAAGAATGGGGAATGAAACAGG - Intronic
1057953075 9:99385449-99385471 CAGACCATAGGGAAAGAGCCTGG + Intergenic
1058504016 9:105651145-105651167 CATAACATGAGGCATGAGAAAGG + Intergenic
1060245928 9:121946281-121946303 CAGGAGCTGGGGAATGAGATAGG + Intronic
1061766027 9:132882034-132882056 CTGAAGGTGGGGAATGAGATGGG - Intronic
1186639285 X:11437849-11437871 CAGAAGCTGGTGAATGGGACAGG + Intronic
1186840785 X:13483076-13483098 CAGGACATGGAAAATGAGAAGGG + Intergenic
1187252582 X:17612325-17612347 CAGAACCGGGGGAAAGAGGCAGG - Intronic
1190290436 X:48988836-48988858 GGGAACATGGGGTCTGAGACGGG - Intronic
1191184569 X:57594948-57594970 TAGAACATGGGGAGTGAGTGAGG - Exonic
1193038215 X:76976579-76976601 CAGAACATGGAGAAACAAACTGG + Intergenic
1194764623 X:97835568-97835590 GATAACATGGTGAATAAGACAGG + Intergenic
1195611961 X:106877682-106877704 CAGAACATGGTGAAAGGGATGGG - Intronic
1196315363 X:114215900-114215922 CAGTGCATGAGTAATGAGACTGG + Intergenic
1197922856 X:131613779-131613801 CAGATAATGGGTAATAAGACTGG - Intergenic