ID: 1007784827

View in Genome Browser
Species Human (GRCh38)
Location 6:44273570-44273592
Sequence CTCCCTCCCCACCTCCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1159
Summary {0: 1, 1: 2, 2: 23, 3: 142, 4: 991}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007784827 Original CRISPR CTCCCTCCCCACCTCCCTGG GGG Intronic