ID: 1007789951

View in Genome Browser
Species Human (GRCh38)
Location 6:44303147-44303169
Sequence GATACCACCCGCACAGGGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007789943_1007789951 6 Left 1007789943 6:44303118-44303140 CCAATGCATGGGCCACGGGCACC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 1007789951 6:44303147-44303169 GATACCACCCGCACAGGGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 69
1007789944_1007789951 -6 Left 1007789944 6:44303130-44303152 CCACGGGCACCCCCACTGATACC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1007789951 6:44303147-44303169 GATACCACCCGCACAGGGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007789951 Original CRISPR GATACCACCCGCACAGGGTC TGG Exonic
902572696 1:17356812-17356834 GATACCACAGGCAGAGGGACGGG + Intronic
902875755 1:19339824-19339846 TATGCCACCCCCACAGGGCCTGG - Intronic
910428928 1:87142091-87142113 GACTCCACCCACCCAGGGTCAGG + Intronic
910604941 1:89072708-89072730 GATACCAGGCAAACAGGGTCTGG + Intergenic
911813343 1:102312057-102312079 GATACCAGGCAAACAGGGTCTGG - Intergenic
912894773 1:113575487-113575509 GATACCAGGCAAACAGGGTCTGG - Intronic
1067579461 10:47433111-47433133 GATACCAGGCAAACAGGGTCAGG - Intergenic
1068469968 10:57448409-57448431 GATCCCACCTGCACAGAGCCTGG - Intergenic
1070999826 10:80818726-80818748 GATACCAGGCAAACAGGGTCTGG + Intergenic
1071838649 10:89445447-89445469 GATACCAGGCAAACAGGGTCTGG + Intronic
1072202550 10:93174024-93174046 GAGACCTTCCTCACAGGGTCAGG + Intergenic
1075891734 10:125957253-125957275 GATAACAACAGCACAGAGTCTGG - Intronic
1086078574 11:82879804-82879826 GATACCAGGCAAACAGGGTCTGG - Intronic
1090472125 11:126990024-126990046 GATTCCACCCTTCCAGGGTCAGG - Intronic
1091160538 11:133415631-133415653 GGTACCACATGCACAGGTTCCGG - Intronic
1097735091 12:63173741-63173763 AATAGCACCCACACAGGGGCTGG - Intergenic
1100218146 12:92475048-92475070 AATACCACCCACACAGCCTCTGG - Intergenic
1101265212 12:103077542-103077564 GATTGCTCCAGCACAGGGTCTGG - Intergenic
1101947631 12:109150025-109150047 GTTACCTCCCTCACAGGGTTGGG + Intronic
1102533321 12:113562971-113562993 CATTCCACCAGCACAGTGTCAGG + Intergenic
1103972299 12:124679737-124679759 GATTCCACCCCCACACGCTCCGG - Intergenic
1104770094 12:131356157-131356179 GACATCACCCTCACAGCGTCGGG - Intergenic
1108235146 13:48395090-48395112 GATACCAGGCAAACAGGGTCTGG + Intronic
1113881615 13:113629944-113629966 CATACCACACGCACAGGTACAGG - Intronic
1116634525 14:47378082-47378104 GATACCAGTCAAACAGGGTCTGG + Intronic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1119616068 14:76099914-76099936 GGTGCCACCCACACAGGGTATGG - Intergenic
1130956698 15:88631886-88631908 GTCACCTCCCGCACAGTGTCGGG - Exonic
1132205908 15:99986031-99986053 TGTACCACCAGCACAGGGTCTGG + Intronic
1132685906 16:1162024-1162046 GACACGACCCCGACAGGGTCCGG - Intronic
1139891839 16:70258117-70258139 GAGACGACTCGCACAGGGTCAGG + Exonic
1143344927 17:6242449-6242471 CATACCCCCAGCACAGGATCAGG - Intergenic
1144451483 17:15383498-15383520 GATGCCAACCTCACTGGGTCAGG - Intergenic
1154338387 18:13483652-13483674 GATACAACACGCACAGTATCTGG - Intronic
935726158 2:106025932-106025954 GGTATCAGACGCACAGGGTCAGG + Intergenic
938163129 2:129004457-129004479 GAGTCCACCTGCACAGGCTCTGG - Intergenic
938248630 2:129797315-129797337 GCTGCCACCCGCCCTGGGTCAGG + Intergenic
939437017 2:142190454-142190476 CATAACACCCTCAGAGGGTCAGG + Intergenic
942615410 2:177786262-177786284 GATACCAGGCAAACAGGGTCTGG + Intronic
1172408246 20:34704705-34704727 GGTACCGCCCCCACAGGCTCGGG + Intronic
1179036628 21:37763587-37763609 GATACCAGAAGCACAGGGTGAGG - Intronic
1180215889 21:46323742-46323764 GCAACCACCCGGACAGGGCCAGG - Exonic
1182129517 22:27840657-27840679 GATGGCAGCCGGACAGGGTCAGG + Intergenic
954115658 3:48465713-48465735 GATCCCAGCCACTCAGGGTCCGG - Exonic
954274025 3:49531025-49531047 GATACCACCTCACCAGGGTCTGG - Exonic
955396651 3:58562507-58562529 GGTCCCACCCTCACAGGGTTTGG + Intergenic
956159720 3:66336517-66336539 GTTAGAACTCGCACAGGGTCAGG - Intronic
960037964 3:113120685-113120707 GATACCACCAGCCCAGGGCCAGG + Intergenic
962901170 3:139763025-139763047 GACACCAACCTCACAGGGACAGG + Intergenic
974979349 4:68935403-68935425 GATACCAGGCAAACAGGGTCTGG + Intronic
976501015 4:85789051-85789073 GATAGCTCCAGCATAGGGTCTGG + Intronic
984627562 4:182024832-182024854 GCTACCACCCTCCCAGCGTCTGG + Intergenic
984921462 4:184767810-184767832 GATACCCACCGCAGAGGGGCTGG + Intronic
985107705 4:186515124-186515146 GATCCCACTGACACAGGGTCTGG + Intronic
991106732 5:62851942-62851964 GATACCACCTGCTGAGGGTAAGG + Intergenic
996859164 5:128044755-128044777 GATACCAGGCAAACAGGGTCTGG + Intergenic
998897809 5:146818582-146818604 GATAGAACCCGCACATGGTAAGG - Intronic
1000241110 5:159409004-159409026 GATAGCAAACGCACAGGCTCTGG + Intergenic
1003961324 6:11211857-11211879 GAATCTACCCACACAGGGTCAGG + Intronic
1006988535 6:38193450-38193472 GAAACCACCCAGACAGAGTCAGG - Intronic
1007789951 6:44303147-44303169 GATACCACCCGCACAGGGTCTGG + Exonic
1011848068 6:91590805-91590827 GATACCAGGCAAACAGGGTCTGG + Intergenic
1029562089 7:101309226-101309248 GGGACCAGCCCCACAGGGTCGGG + Intergenic
1031613672 7:123856491-123856513 GATACCAGGCAAACAGGGTCTGG - Intronic
1032312489 7:130801824-130801846 GATACCAGGCAAACAGGGTCTGG - Intergenic
1039613474 8:38937108-38937130 CATACCACAGGCACAGGGGCGGG - Intronic
1049767226 8:144360508-144360530 AGTTCCACCCGCACAGGGGCTGG - Intronic
1049821233 8:144634890-144634912 GACTACACCCGCACAGGGCCTGG - Intergenic
1050448784 9:5757371-5757393 GATACCACCAGGAAAGGGTGAGG - Exonic
1053412853 9:37926905-37926927 GATCCCACTCACACAGGGCCTGG + Intronic
1199469833 X:148181972-148181994 GATCCCACCCCCACAGAGCCCGG - Intergenic
1199886365 X:152025421-152025443 GATACCCACAGCACAGGGCCAGG - Intergenic
1200321946 X:155198483-155198505 GATACCAGGCAAACAGGGTCTGG + Intronic