ID: 1007790837

View in Genome Browser
Species Human (GRCh38)
Location 6:44307228-44307250
Sequence CTGTAGCCCTTCCAGACTCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 342}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007790827_1007790837 9 Left 1007790827 6:44307196-44307218 CCACCTGAGACCCCCAGCAGCCC 0: 1
1: 2
2: 4
3: 41
4: 458
Right 1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG 0: 1
1: 0
2: 0
3: 29
4: 342
1007790830_1007790837 -2 Left 1007790830 6:44307207-44307229 CCCCAGCAGCCCCTGTCCTCTCT 0: 1
1: 1
2: 9
3: 74
4: 710
Right 1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG 0: 1
1: 0
2: 0
3: 29
4: 342
1007790831_1007790837 -3 Left 1007790831 6:44307208-44307230 CCCAGCAGCCCCTGTCCTCTCTG 0: 1
1: 0
2: 7
3: 48
4: 511
Right 1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG 0: 1
1: 0
2: 0
3: 29
4: 342
1007790828_1007790837 6 Left 1007790828 6:44307199-44307221 CCTGAGACCCCCAGCAGCCCCTG 0: 1
1: 0
2: 7
3: 73
4: 598
Right 1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG 0: 1
1: 0
2: 0
3: 29
4: 342
1007790822_1007790837 20 Left 1007790822 6:44307185-44307207 CCCTCCCTCCTCCACCTGAGACC 0: 1
1: 0
2: 4
3: 53
4: 599
Right 1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG 0: 1
1: 0
2: 0
3: 29
4: 342
1007790832_1007790837 -4 Left 1007790832 6:44307209-44307231 CCAGCAGCCCCTGTCCTCTCTGT 0: 1
1: 0
2: 5
3: 73
4: 638
Right 1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG 0: 1
1: 0
2: 0
3: 29
4: 342
1007790824_1007790837 16 Left 1007790824 6:44307189-44307211 CCCTCCTCCACCTGAGACCCCCA 0: 1
1: 1
2: 5
3: 82
4: 508
Right 1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG 0: 1
1: 0
2: 0
3: 29
4: 342
1007790823_1007790837 19 Left 1007790823 6:44307186-44307208 CCTCCCTCCTCCACCTGAGACCC 0: 1
1: 0
2: 3
3: 73
4: 679
Right 1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG 0: 1
1: 0
2: 0
3: 29
4: 342
1007790826_1007790837 12 Left 1007790826 6:44307193-44307215 CCTCCACCTGAGACCCCCAGCAG 0: 1
1: 0
2: 3
3: 33
4: 301
Right 1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG 0: 1
1: 0
2: 0
3: 29
4: 342
1007790829_1007790837 -1 Left 1007790829 6:44307206-44307228 CCCCCAGCAGCCCCTGTCCTCTC 0: 1
1: 0
2: 13
3: 84
4: 713
Right 1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG 0: 1
1: 0
2: 0
3: 29
4: 342
1007790821_1007790837 26 Left 1007790821 6:44307179-44307201 CCTGTTCCCTCCCTCCTCCACCT 0: 1
1: 1
2: 21
3: 200
4: 1896
Right 1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG 0: 1
1: 0
2: 0
3: 29
4: 342
1007790825_1007790837 15 Left 1007790825 6:44307190-44307212 CCTCCTCCACCTGAGACCCCCAG 0: 1
1: 0
2: 2
3: 62
4: 560
Right 1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG 0: 1
1: 0
2: 0
3: 29
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007790837 Original CRISPR CTGTAGCCCTTCCAGACTCA CGG Exonic
900983574 1:6060212-6060234 CTGGAGCCCTGCCATACTCCTGG + Intronic
900999555 1:6142020-6142042 CGGTAGCCCTCCCAGGCTGAGGG + Intronic
904342377 1:29845273-29845295 CTGTAGCAAGTCCAGCCTCAGGG - Intergenic
904867751 1:33595185-33595207 CTGGAACCATTCCAGACTAAAGG - Intronic
905756082 1:40510080-40510102 CTGTAGGACTCCCAGACTCTTGG + Intronic
909745257 1:79087781-79087803 CAGTAGCTCTTCCAGGGTCATGG + Intergenic
910357528 1:86377355-86377377 CTGTGGCTCTTCCAGGCACATGG + Intronic
910846194 1:91606654-91606676 CTGTAGCCGGTCCATATTCAGGG - Intergenic
911007572 1:93242980-93243002 CTGTGGCTTTTCCAGGCTCATGG + Intronic
911686223 1:100780492-100780514 CTGTAGCTTTTCCAGGCACATGG + Intergenic
912182743 1:107238030-107238052 CTGCAGCTTTTCCACACTCACGG - Intronic
913217748 1:116634734-116634756 CTGTAGCCCACCTAGATTCAGGG - Intronic
913410104 1:118542093-118542115 CTGTAGCCTTTCCAGCCTCCAGG + Intergenic
913459046 1:119064001-119064023 CTGTGGCTTTTCCAGGCTCACGG - Intronic
915988415 1:160489465-160489487 CTTTAGCCCTTCCATAGGCAGGG - Intronic
916826837 1:168450305-168450327 CTTTGGCCCCTTCAGACTCAAGG + Intergenic
918920165 1:190698629-190698651 CTGCAGCTTTTCCAGGCTCACGG - Intergenic
918926015 1:190787209-190787231 TTGAAGGCCTTCCAGATTCATGG - Intergenic
919409644 1:197227626-197227648 CTGTGGCTTTTCCAGGCTCATGG + Intergenic
920270050 1:204755915-204755937 CTGGAGCCCTTCCACAGCCATGG + Intergenic
920566335 1:206976479-206976501 TGGTAGGCCTTCCAGCCTCATGG + Intergenic
922728667 1:227938946-227938968 CTGCACCCCTGCCAGGCTCACGG + Intronic
923097185 1:230784884-230784906 CTGTGGCTTTTCCAGGCTCAAGG - Intronic
924792749 1:247268601-247268623 CTGTGGTTCTTGCAGACTCATGG + Intergenic
1064169057 10:13013828-13013850 CTGTAGCTGTTCCAGATTGAAGG + Intronic
1064776113 10:18779150-18779172 CCCTAGCCCATCCAGATTCAAGG - Intergenic
1064974746 10:21101708-21101730 CAGAAGCTCTTCCAGACCCAAGG + Intronic
1066258377 10:33704125-33704147 CTGAAGCCCTTCCTGACTGAAGG + Intergenic
1067062874 10:43086967-43086989 CTGGACCCCTTCCCCACTCACGG + Intronic
1068205383 10:53843866-53843888 CAGAAGCCATTCCAGACACATGG + Intronic
1069040850 10:63694124-63694146 CTGTGGCTTTTCCAGACACATGG - Intergenic
1069499749 10:68941070-68941092 CTCTAGGCTTTCCAGAGTCATGG - Exonic
1069737279 10:70665104-70665126 CTGGAGCTCTGCCAGACTCCTGG + Intergenic
1069742058 10:70691053-70691075 CTGGAGCCCAGCCAGACTCAGGG - Intronic
1070447809 10:76524728-76524750 CCCTGGTCCTTCCAGACTCACGG - Intronic
1071258463 10:83896595-83896617 CTGTGGTCCTTTCAGACTCACGG - Intergenic
1071889120 10:89983199-89983221 CATTAGCCTTTCCAGAGTCAGGG - Intergenic
1073215582 10:101834349-101834371 CTCCAGCCCTTCCAGGTTCATGG + Intronic
1073704681 10:105969825-105969847 CTGAAGCCCTTCGTGAATCAGGG + Intergenic
1073880345 10:107973578-107973600 CTGTGGCTTTTCCAGGCTCACGG - Intergenic
1075079845 10:119376034-119376056 CTGAATCCATTCCAGACTCCTGG + Intronic
1076766184 10:132634838-132634860 CCGCAGCCCTCCCAGGCTCATGG + Intronic
1079181908 11:18201301-18201323 CTGCAGCTTTTCCAGACACACGG + Intronic
1080739364 11:35049360-35049382 CTGTGGCTTTTCCAGGCTCACGG - Intergenic
1080958573 11:37130621-37130643 CTGTGGCTCTTCCAGGCACACGG - Intergenic
1081080438 11:38733468-38733490 CTGCAGCTTTTCCAGACACATGG + Intergenic
1081212473 11:40354094-40354116 CTGTGACTCTTGCAGACTCAAGG + Intronic
1082025172 11:47566041-47566063 CTCTAGCCGTCCCAGGCTCAGGG - Intronic
1084605017 11:70167445-70167467 CTGCAGCCCTTCCCCACTCCAGG - Intronic
1084838795 11:71828019-71828041 CTGCAGCTTTTCCAGGCTCAGGG - Intergenic
1085981527 11:81732365-81732387 CTGTAGTTCTTGCAGACACATGG + Intergenic
1086078345 11:82877895-82877917 CTGTGGCTTTTCCAGGCTCACGG - Intronic
1087578827 11:100025543-100025565 CTGCAGCTTTTCCAGGCTCATGG - Intronic
1088071646 11:105793673-105793695 CTTTAGCTCTACCAGACACAGGG + Intronic
1088590954 11:111402701-111402723 CTTTAGCCTTCCCAGCCTCAAGG + Intronic
1089654879 11:119940128-119940150 CTGTAGTCATGCCAGGCTCAGGG - Intergenic
1090295461 11:125583893-125583915 CTGTGGTCCTTTCAGACTCACGG - Exonic
1090319595 11:125830884-125830906 CTGTGGCTTTTCCAGGCTCAAGG + Intergenic
1091628035 12:2137849-2137871 CGGCAGCCCTGCCAGACTCTTGG - Intronic
1092399880 12:8166070-8166092 CTGCAGCTTTTCCAGGCTCAGGG + Intronic
1092471588 12:8786527-8786549 CTGTGGCCTTTTCAGGCTCAGGG + Intergenic
1093324708 12:17759800-17759822 CTGTGGCTTTTCCAGACACACGG + Intergenic
1094767922 12:33619012-33619034 CTGTGGCTTTTCCAGACACATGG - Intergenic
1095195306 12:39308006-39308028 TTTTAGCCCTTCCTAACTCAGGG - Intronic
1095498987 12:42815907-42815929 CAGTAGGCCTTCCCTACTCAAGG - Intergenic
1095728107 12:45474319-45474341 CTGTGGCTTTTCCAGGCTCAGGG - Intergenic
1096107307 12:49003869-49003891 CTGTAGCTCTTCCAGAGACTTGG + Exonic
1096417869 12:51429247-51429269 TTGTGGCCCTGCCAGACCCAGGG + Intronic
1096748007 12:53741108-53741130 CTTTTGCCCTTCCAGGCACAGGG + Intergenic
1098939491 12:76518422-76518444 CTGCAGCTTTTCCAGGCTCAGGG + Intronic
1100595205 12:96065672-96065694 CCGTTGCCCTTCAAGCCTCAGGG - Intergenic
1102739504 12:115194651-115194673 CCGTAGACCTGCCAGACGCAGGG + Intergenic
1104172062 12:126291731-126291753 CTGCAGCTTTTCCAGGCTCATGG + Intergenic
1104829590 12:131740889-131740911 GTGAAGCCCTGCCACACTCATGG - Intronic
1104973767 12:132542973-132542995 CTGCACCCCTTCCAGACCCTGGG - Intronic
1105257647 13:18754886-18754908 CTGTAGCTTTTCCACACTAAGGG + Intergenic
1108399839 13:50029001-50029023 CTGCAGCCCTTCAAGAGCCATGG - Intergenic
1108956622 13:56166582-56166604 CTGTGGCTTTTCCAGACACATGG + Intergenic
1110901793 13:80833974-80833996 CTGCAGCTTTTCCAGGCTCATGG + Intergenic
1112450949 13:99509222-99509244 CTGTAGCTTTTCCAGGCACAGGG + Intronic
1112995972 13:105575520-105575542 CTGCAGCCTTTCCAGATGCACGG - Intergenic
1113280569 13:108783103-108783125 CTGTGGCTTTTCCAGGCTCATGG - Intronic
1113341738 13:109432549-109432571 CTGTGGCTTTTCCAGACACATGG + Intergenic
1113868532 13:113544314-113544336 CAGCAGCCCTTCCTCACTCAGGG - Intronic
1115132742 14:30073091-30073113 CTGTGGCCTTTCCAGATGCATGG - Intronic
1115410225 14:33065875-33065897 CTGTATACCTTCCAGTGTCAAGG - Intronic
1115661138 14:35495215-35495237 CTGTGGATCTTGCAGACTCATGG - Intergenic
1117084059 14:52181085-52181107 CTGCAGCTCTTCCAGGTTCATGG + Intergenic
1117264791 14:54076032-54076054 CTGTGGTTCTTGCAGACTCATGG + Intergenic
1118076180 14:62301791-62301813 CTGAAACCCTTCCAGACTGGTGG - Intergenic
1118915123 14:70096284-70096306 ATGTAGCCCATCCAAACACAGGG - Intronic
1120347434 14:83308534-83308556 CTGTAGCTCCCCCATACTCAAGG - Intergenic
1121215517 14:92244670-92244692 CTGTAGCTTTTCCAGGCTGAGGG + Intergenic
1121581709 14:95036969-95036991 CTTTACCCCTCCCTGACTCAAGG - Intergenic
1121653061 14:95574190-95574212 CTGTTACCCTTCCAGCCTCAGGG + Intergenic
1121841710 14:97139850-97139872 CTGTAGGCCTTCAAGGCCCAGGG + Intergenic
1122862629 14:104589351-104589373 CTGGGGCCTCTCCAGACTCACGG - Exonic
1123064663 14:105611428-105611450 CTGTGGCTTTTCCAGATTCAGGG - Intergenic
1123073966 14:105657069-105657091 CTGTGGCTTTTCCAGATTCAGGG - Intergenic
1123087967 14:105726652-105726674 CTGTGGCTTTTCCAGATTCAGGG - Intergenic
1123093925 14:105756025-105756047 CTGTGGCTTTTCCAGATTCAGGG - Intergenic
1202835342 14_GL000009v2_random:74043-74065 CTGTAGCATTTCCATACTAAGGG - Intergenic
1125304176 15:38291345-38291367 CTGTGGCTTTTCCAGACACATGG + Intronic
1125407621 15:39369934-39369956 CTGCAGCTTTTCCAGACACATGG + Intergenic
1126791585 15:52226501-52226523 CTGGAGCCCTTAAATACTCAGGG - Intronic
1126942783 15:53784582-53784604 CTGTGGCTTTTCCAGGCTCATGG + Intergenic
1130153718 15:81332256-81332278 CTGTAGCCCTGTCAGCCTCAGGG + Exonic
1130669146 15:85895006-85895028 CTATTGACCTTCCTGACTCAGGG - Intergenic
1130832093 15:87611285-87611307 CTGTAACCCTTCCTGTCTAATGG + Intergenic
1132509471 16:330979-331001 CTGCAGCCCTTGCAGACTGCAGG + Intronic
1132601333 16:774471-774493 CTGTAGCCCCTCCAGTGTCCAGG + Exonic
1135421533 16:22308550-22308572 CTCTAGCCCCTCCAGCCACATGG + Intronic
1136542287 16:30934738-30934760 CTGTTGCCCATCCAGGCTCCTGG - Intronic
1138548586 16:57734948-57734970 CCGTAACCCTTCTCGACTCAGGG - Intergenic
1138859937 16:60744045-60744067 CTGCAGCTTTTCCAGGCTCACGG + Intergenic
1139339681 16:66259797-66259819 CTATAGCCCTTAGAGACACATGG - Intergenic
1141166721 16:81665772-81665794 CTCTACCCCTTCCATGCTCATGG + Intronic
1143455932 17:7067784-7067806 CTGTAGCTTTTCCAGGCACAGGG + Intergenic
1147385230 17:40077170-40077192 CTGAGGCCCTACCAGAATCAGGG + Intronic
1148581849 17:48749789-48749811 CTGTAGCCCCTCCAGGCACCTGG + Intergenic
1149173658 17:53843895-53843917 CTGGAGCCCTTCAAGAAACAAGG + Intergenic
1149635304 17:58162705-58162727 CACAAGCCCTTCCAGATTCAAGG - Intergenic
1150702752 17:67461992-67462014 CAGAAGCCCTTCCAGAAACAGGG - Intronic
1150842408 17:68621087-68621109 CTGTAACCCTTCCCTTCTCACGG - Intergenic
1152263778 17:79281546-79281568 CTGCAGCTCCTCCAGACCCAAGG - Intronic
1154428232 18:14288491-14288513 CTGTAGCTTTTCCACACTAAGGG + Intergenic
1154433197 18:14324146-14324168 CTGTAGCTTTTCCACACTAAGGG + Intergenic
1155108128 18:22687641-22687663 CTGGAGCTTTTCCAGGCTCAGGG + Intergenic
1155422780 18:25673062-25673084 CAGTAGCCTTTCAAGATTCAAGG - Intergenic
1157879440 18:51305718-51305740 CTGTGGCTCTTGCAGACTTATGG - Intergenic
1159798558 18:72869470-72869492 CTGAATCCCTTCCAGACTTGGGG - Intergenic
1160182496 18:76647726-76647748 ATTTAGCCCTTCCAGCCTCCAGG - Intergenic
1162390416 19:10386389-10386411 CTGCAGCCCTTGCAGAGCCAGGG - Intergenic
1163036795 19:14574331-14574353 CTTGTGCCCTTCTAGACTCAAGG + Intergenic
1163495375 19:17643606-17643628 CTGTAGTCCTCCCAGACTTCCGG + Intronic
1164489383 19:28692700-28692722 CTGTGGCTTTTCCAGGCTCAGGG - Intergenic
1165974740 19:39665867-39665889 CTGAAGCTTTTCCAGGCTCATGG + Intergenic
1166931404 19:46303717-46303739 GTGTAGCCCTTCCAGGCCCAGGG + Intronic
1167380989 19:49138035-49138057 CTGAAGGCCTTCCAGGCTCAAGG - Intronic
1202637282 1_KI270706v1_random:53306-53328 CTGTAGCATTTCCATACTAAGGG + Intergenic
925554463 2:5114560-5114582 CTGTAGCTTTTCCAGGCACAGGG - Intergenic
926611869 2:14955353-14955375 CTGTGGCTTTTCCAGGCTCATGG + Intergenic
926889698 2:17628728-17628750 CTGTGGCCCTTTTAAACTCAAGG - Intronic
927159356 2:20242947-20242969 CTGTCACCCTTCCAAACTCTGGG + Intergenic
927313817 2:21659004-21659026 CTGGAGCCCTTAGAGCCTCAGGG + Intergenic
927478540 2:23432760-23432782 CTGTTGCCTTTCCAGCCTCAGGG - Intronic
928267562 2:29824423-29824445 CTGTGGCTTTTCCAGGCTCATGG - Intronic
928532159 2:32203564-32203586 CTCTAGGCTTTCCAGAGTCATGG - Intronic
929689135 2:44060064-44060086 CTGCAGCTCTTCCAGGCGCATGG + Intergenic
930404895 2:50942419-50942441 CTGCAGCCTTTCCAGGTTCATGG - Intronic
934491983 2:94767767-94767789 CTGTAGCTTTTCCATACTGAGGG - Intergenic
934492449 2:94770910-94770932 CTGTAGCTTTTCCATACTGAGGG - Intergenic
934492585 2:94771785-94771807 CTGTAGCTTTTCCACACTGAGGG - Intergenic
934494112 2:94782630-94782652 CTGTAGCTTTTCCATACTGAGGG + Intergenic
934494336 2:94784311-94784333 CTGTAGCTTTTCCACACTGAGGG - Intergenic
936243341 2:110806679-110806701 CTGCAGACCATCCTGACTCAGGG + Intronic
936260431 2:110955709-110955731 CTGTACCCCTTCATGCCTCAGGG + Intronic
936462389 2:112722860-112722882 CTGGAGCCCTTCCAGCCTCTTGG - Intronic
936470177 2:112791710-112791732 CTGCAGCTTTTCCAGGCTCAGGG - Intergenic
936896635 2:117435183-117435205 CTGTTTCCCTTCCACATTCATGG + Intergenic
936920534 2:117684275-117684297 CTCCAGTCCTCCCAGACTCATGG + Intergenic
937327932 2:121003224-121003246 CTGCAGCTTTTCCAGGCTCAGGG - Intergenic
937617719 2:123945189-123945211 CTGTGGCTCTTATAGACTCATGG - Intergenic
938165418 2:129021544-129021566 CTGTGGCTTTTCCAGGCTCACGG - Intergenic
938280072 2:130057557-130057579 CTGTAGCTTTTCCACACTGAGGG + Intergenic
938331029 2:130448272-130448294 CTGTAGCTTTTCCACACTGAGGG + Intergenic
938358919 2:130673231-130673253 CTGTAGCTTTTCCACACTGAGGG - Intergenic
938435310 2:131279884-131279906 CTGTAGCTTTTCCACACTGAGGG - Intronic
939707773 2:145477169-145477191 CTGTAGTCTTTGCAGACTCATGG + Intergenic
940825660 2:158409273-158409295 CTGTTGCTTTTCCAGGCTCATGG - Intronic
941307728 2:163892060-163892082 CTGCAGCCTTTCCAGGCACACGG + Intergenic
941641699 2:167995906-167995928 CTGCAGCCCATGCAGACACATGG + Intronic
943297904 2:186161288-186161310 CTGTAGCTTTTCCAGGCACATGG - Intergenic
944011415 2:194979315-194979337 CTGTAGCTTTTCCAGGCACATGG + Intergenic
945062787 2:205923651-205923673 CTTGAGTCCTTCCAGACCCAAGG + Intergenic
948105756 2:235412379-235412401 CTGAATCCCATCCAGGCTCAGGG + Intergenic
948701775 2:239765131-239765153 CTGTGGCCCTGCCTGACTCTTGG - Intronic
1169587155 20:7097492-7097514 CTGTAGTTCTTGAAGACTCATGG - Intergenic
1169805388 20:9554233-9554255 CACAAGCCCTTCCAGATTCAGGG - Intronic
1170069405 20:12348557-12348579 TTGTTGCCCTTAGAGACTCAAGG + Intergenic
1170318675 20:15069976-15069998 CTGTGGCTTTTCCAGGCTCAAGG - Intronic
1171375817 20:24693628-24693650 CTCTGGCCCTTCCAGACTCCAGG - Intergenic
1171883258 20:30633139-30633161 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1171885003 20:30645760-30645782 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1171938464 20:31300082-31300104 CTGTTGCTCTTCCAGATTCCTGG - Intergenic
1173139655 20:40470927-40470949 CGGTCAGCCTTCCAGACTCAGGG - Intergenic
1173150731 20:40564749-40564771 ATGTAGAGATTCCAGACTCAGGG + Intergenic
1174190202 20:48735090-48735112 ATGTACTCCTTCCAGACTAAAGG + Intronic
1174591017 20:51645185-51645207 CTGTAGCCCTTCCCCACCCCTGG + Intronic
1176842500 21:13851898-13851920 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1177328791 21:19629273-19629295 CTGTGGCTTTTCCAGGCTCAAGG - Intergenic
1177554561 21:22672533-22672555 CTGTGGCTTTTCCAGGCTCATGG - Intergenic
1178720386 21:35003786-35003808 CTGCAGCCCTTTCAGTCTCAGGG - Intronic
1183779443 22:39989324-39989346 CCACAGACCTTCCAGACTCAGGG - Intergenic
1184713215 22:46265327-46265349 CTGCAGCTTTTCTAGACTCATGG + Intergenic
1184925543 22:47634056-47634078 GTCTAGCCCTTCCTGACTCCTGG + Intergenic
1185048644 22:48541781-48541803 CTGCAGCCCTGCCAGGCTCCGGG + Intronic
949665361 3:6332234-6332256 CTGTAGCTTTTCCAGGCACATGG - Intergenic
950704811 3:14773153-14773175 CTGAGGCCCTCCCACACTCAAGG + Intergenic
952670841 3:35966263-35966285 TTAAAGTCCTTCCAGACTCAGGG + Intergenic
953584165 3:44184897-44184919 CTGGAGCCATTCTAGACACAGGG + Intergenic
954445777 3:50546093-50546115 CTCTGGCCCTTCCAGACTTTGGG + Intergenic
954698842 3:52441402-52441424 CTGTCACCCTTCCAGACCCCCGG - Exonic
956149385 3:66225041-66225063 CTGTAGCTTTTCCAGGCACAGGG + Intronic
957689758 3:83552788-83552810 CTGTAGCCCACCCACACTGAGGG + Intergenic
957870278 3:86082946-86082968 CTGTGGCTTTTCCAGGCTCACGG + Intergenic
959756465 3:109905719-109905741 CTGCAGCTTTTCCAGGCTCATGG + Intergenic
959818856 3:110708342-110708364 CTGTGGTTCTTGCAGACTCATGG + Intergenic
959936194 3:112031690-112031712 CTGTGGCTCTTCCAGATGCATGG - Intergenic
960499483 3:118419270-118419292 CTGTGGCCTTTCCAGGCACATGG + Intergenic
960597801 3:119422422-119422444 CCCTAGCCTTTCCAGACTTAAGG + Intergenic
963046312 3:141105013-141105035 CTGAAGACTTTCCAGACTCAGGG - Intronic
963541641 3:146598307-146598329 TTGTGTCTCTTCCAGACTCATGG + Intronic
963716727 3:148811920-148811942 CTGTGGCTTTTCCAGGCTCACGG - Intronic
964221552 3:154352562-154352584 CTCTAGGCTTTCCAGAGTCATGG + Intronic
964256455 3:154779832-154779854 CTGGAGAGCTTCCAGACTCATGG + Intergenic
964529127 3:157648127-157648149 TTGTAGCTGTTCCAGTCTCATGG + Intronic
965198889 3:165631563-165631585 CTGCAGCTTTTCCAGGCTCACGG - Intergenic
965397230 3:168174263-168174285 CTGTAGGTTTTCCAGACACATGG + Intergenic
968350502 3:198048443-198048465 CTGTAGCTTTTCCATACTGAGGG - Intergenic
969345202 4:6565434-6565456 CTGTCTCCCTTGCACACTCAAGG - Intergenic
969780216 4:9395503-9395525 CTGCAGCTTTTCCAGGCTCAGGG - Intergenic
970706974 4:18816116-18816138 CTGTAGCTTTTCCAGATTGAGGG - Intergenic
972367846 4:38392839-38392861 TTGTAGCATTTCCAGGCTCAGGG - Intergenic
973162980 4:47041661-47041683 CTCTAGCCCTCCATGACTCACGG + Intronic
973393520 4:49575759-49575781 CTGTAGCATTTCCATACTAAGGG - Intergenic
974867402 4:67597531-67597553 CTGTGGCATTTCCAGACACATGG - Intronic
975035208 4:69670706-69670728 CTGTAGTTCTTGCAGGCTCATGG - Intergenic
976057137 4:81081700-81081722 CTGCAGCTTTTCCAGACACATGG - Intergenic
976672887 4:87673751-87673773 CTGTAGCTTTTCCAGCCACATGG + Intergenic
977512073 4:97973996-97974018 CTGTAGCTTTTCCAGGCACATGG - Intronic
978171720 4:105679448-105679470 CTCTAGGCTTTCCAGAGTCATGG + Exonic
978793958 4:112690456-112690478 CTGCAGCCCTCCTAGTCTCAAGG - Intergenic
978921070 4:114183497-114183519 CTGTGGCTTTTCCAGGCTCATGG - Intergenic
979153168 4:117346041-117346063 CTGTACCCCTTCCAAACACAAGG - Intergenic
979439551 4:120734921-120734943 CTGCAGCCCTTGCAGAGTCTGGG - Intronic
980686596 4:136237729-136237751 CTGTTGCCTTTCCAGGCACATGG - Intergenic
981964161 4:150580748-150580770 CTGTAGCCTTTCCATACTTTTGG - Intronic
982210158 4:153028295-153028317 CTGTGGCTCTTCCAGGCTCAGGG + Intergenic
982609138 4:157551493-157551515 CTGTAGCTTTTCCAGGCACATGG - Intergenic
983785954 4:171729522-171729544 CTGTGGCTTTTCCAGACACACGG - Intergenic
984353177 4:178621828-178621850 CTGTGGCTTTTCCAGGCTCAAGG + Intergenic
985371769 4:189292600-189292622 CTGTGGCTTTTCCAGGCTCATGG - Intergenic
1202764601 4_GL000008v2_random:139163-139185 CTGTAGCATTTCCATACTAAGGG + Intergenic
986924559 5:12731261-12731283 CTGCAGCTTTTCCAGGCTCAGGG + Intergenic
989472807 5:41839931-41839953 CTGCAGCCTTTCCAGGCTTAAGG - Intronic
991354404 5:65752955-65752977 TTTTAGCCCTTCCAGGTTCAGGG + Intronic
991565117 5:67997056-67997078 GGGTAGACCTTCCTGACTCATGG - Intergenic
992086214 5:73280684-73280706 CTGTAGCTCTTCTGGACTGAAGG - Intergenic
993146175 5:84096261-84096283 CTGTGGCTTTTCCAGACACACGG - Intronic
993237334 5:85329957-85329979 CTCTAGTCCTTCCAGAGTTATGG + Intergenic
993580037 5:89649740-89649762 ATGTAGCCTTTCCAGAATCAGGG + Intergenic
993890189 5:93463570-93463592 CTGTAGCTTTTCCAGGCACATGG - Intergenic
994244579 5:97465761-97465783 CTGGAGCCCTTCAAGAATCAAGG + Intergenic
994689485 5:102999405-102999427 CTGTTGCCTTTCCAGGCACATGG + Intronic
994905707 5:105839151-105839173 CTGCAGCTTTTCCAGGCTCAGGG + Intergenic
995626065 5:114077520-114077542 CTGCAGCCCCTCAAGACCCAGGG - Intergenic
996257746 5:121426393-121426415 CTGCAGCCTTTCCAGGCGCATGG + Intergenic
997186376 5:131885537-131885559 CTGTAGTTCTTGCAGACTTATGG - Intronic
997669449 5:135658478-135658500 CTGCAGCCTTTCCAGGCTCATGG + Intergenic
1000239330 5:159394880-159394902 CTGTAGCCATGTGAGACTCAAGG + Intergenic
1002327410 5:178418835-178418857 CTGCAGTCCTGCCAGAATCAGGG - Intronic
1003226853 6:4213946-4213968 CTGTGGCTTTTCCAGGCTCATGG + Intergenic
1004513066 6:16298170-16298192 CTCAAGACCTTCCAGCCTCAAGG - Intergenic
1006374114 6:33662475-33662497 CTGCGGCCCCTCCAGGCTCAAGG - Intronic
1007023875 6:38550041-38550063 CTGTACCTCATCCAGTCTCATGG + Intronic
1007091172 6:39185756-39185778 CTGTAGCCCTCCCGGATTCTGGG - Intergenic
1007193346 6:40038626-40038648 CTCTAGCCCCTCCAGAGGCAGGG + Intergenic
1007655830 6:43450547-43450569 CTGTGGTCTTTCCAGGCTCAGGG + Exonic
1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG + Exonic
1009316056 6:62222938-62222960 CTGTGGCTTTTCCAGACACACGG + Intronic
1010590672 6:77708137-77708159 CTGCAGCTTTTCCAGGCTCAGGG - Intronic
1013250233 6:108326192-108326214 CTGTAGCCCTAGCCTACTCAGGG - Intronic
1014374738 6:120658981-120659003 CTGTAGCTTTTCCAGGCACATGG + Intergenic
1014509923 6:122308208-122308230 CTGTGGCTTTTCCAGGCTCAAGG - Intergenic
1015667754 6:135650709-135650731 CTGTGGCTTTTCCAGACACATGG - Intergenic
1016354005 6:143198022-143198044 CTGTAGCCATTCAAGTCTCCAGG - Intronic
1018223678 6:161607040-161607062 CTGCCTCCCTTCCAGACTGACGG + Intronic
1018548309 6:164962889-164962911 CTGTGGCATTTCCAGAATCAGGG - Intergenic
1019050586 6:169180058-169180080 CTGTGGCTTTTCCAGGCTCACGG + Intergenic
1019578204 7:1747685-1747707 CTGGAGCCCTGCTGGACTCAGGG + Exonic
1020668196 7:11073554-11073576 CTGTGGCTTTTCCAGGCTCAGGG + Intronic
1021762308 7:23913682-23913704 CTGTGGCTCTTCCAGGCACATGG - Intergenic
1022852709 7:34281969-34281991 CTATGGCTCTTCCAGACACAAGG + Intergenic
1023386323 7:39661714-39661736 CTGTGGCTTTTCCAGACTCATGG + Intronic
1023995216 7:45155668-45155690 CGGCAGCCTTTCCACACTCAGGG + Intergenic
1024936879 7:54719710-54719732 CCTTAGCCCCTCCACACTCAGGG + Intergenic
1026077843 7:67189196-67189218 CAGTCGCCCTTCCTGACCCAAGG - Intronic
1026573931 7:71556142-71556164 CTGTAGCCCTTAAATACGCAAGG + Intronic
1026699012 7:72622921-72622943 CAGTCGCCCTTCCTGACCCAAGG + Intronic
1029939421 7:104464319-104464341 CTGTGGCTTTTCCAGGCTCATGG + Intronic
1030072729 7:105711730-105711752 CTGTGGCACTTCCAGGCGCATGG + Intronic
1030144639 7:106341049-106341071 CTGCAGCTTTTCCAGGCTCATGG + Intergenic
1031208452 7:118792416-118792438 CTGTGGCTCTTCTAGACTGAGGG + Intergenic
1031238721 7:119211161-119211183 CTGCAGCTTTTCCCGACTCATGG - Intergenic
1031262049 7:119533400-119533422 CTGTGGCATTTCCAGACACAGGG - Intergenic
1031716642 7:125116640-125116662 CTGCAGCTCTTCCAGAATTAGGG + Intergenic
1032057666 7:128696808-128696830 CTGTAGGGCTTCCAGCATCATGG - Intergenic
1032908907 7:136406724-136406746 CTGTTGCCCTAACAGACTCCAGG + Intergenic
1033063416 7:138129290-138129312 CTGAAGCTTTTCCAGGCTCAGGG + Intergenic
1033221448 7:139528898-139528920 CTGCAGCACTGCCAGACCCAAGG - Intronic
1034070369 7:148179177-148179199 CTGCATCCCTTCCTGACTCAAGG + Intronic
1034224646 7:149473334-149473356 CTGTTGCTCTTCCCCACTCATGG + Exonic
1034526033 7:151663187-151663209 GTGCAGCCCTTCCTTACTCAAGG + Intronic
1034926381 7:155125568-155125590 GTTGAGCCCTTCCAGACCCAAGG - Intergenic
1036277640 8:7369483-7369505 CTGCAGCTTTTCCAGGCTCAGGG - Intronic
1038589605 8:28824602-28824624 CTGTACTCCTGCCAGACTCAGGG - Intronic
1039880231 8:41621081-41621103 CTGTGTCCTTTCCAGACTCCAGG + Exonic
1040102308 8:43516543-43516565 CTGTAGCTTTTCCAGACTGAGGG + Intergenic
1041864061 8:62548436-62548458 CTATAGCCCTTACAGAGCCACGG + Intronic
1044273677 8:90275557-90275579 CTGCAGCTTTTCCAGGCTCATGG - Intergenic
1044328246 8:90885349-90885371 CTGCAGCCCCACCAGACTCTTGG + Intronic
1044885150 8:96769107-96769129 CAGTAGCCTTTCCAGAGACAGGG - Intronic
1048758677 8:137767354-137767376 CTGTAGCCTTTCCAGGTGCATGG - Intergenic
1048783014 8:138022136-138022158 CTGTGGCTTTTCCAGGCTCACGG - Intergenic
1049159187 8:141086532-141086554 CTGGAGCCCTCACAGCCTCACGG + Intergenic
1049417956 8:142504151-142504173 CTCTAGCCCCTCCAAGCTCAGGG - Intronic
1049941065 9:546440-546462 CTGTGACCCTTTCAGGCTCATGG + Intronic
1052752250 9:32503701-32503723 CTGGTGCCCCTCCAGAATCATGG + Intronic
1052878475 9:33585036-33585058 CTGTAGCTTTTCCATACTGAGGG + Intergenic
1053496639 9:38553003-38553025 CTGTAGCTTTTCCATACTGAGGG - Intronic
1053497506 9:38559173-38559195 CTGTAGCTTTTCCATACTGAGGG - Intronic
1053662786 9:40296057-40296079 CTGTAGCTTTTCCACACTGAGGG + Intronic
1053662958 9:40297374-40297396 CTGTAGCTTTTCCATACTGAGGG - Intronic
1053666448 9:40321188-40321210 CTGTAGCTTTTCCATACTGAGGG + Intronic
1053913232 9:42926232-42926254 CTGTAGCTCATCCACACTGAGGG + Intergenic
1053913465 9:42927907-42927929 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1053914193 9:42932689-42932711 CTGTAGCTTTTCCATACTGAGGG + Intergenic
1053916034 9:42946234-42946256 CTGTAGCTTTTCCATACTGAGGG + Intergenic
1054374915 9:64442281-64442303 CTGTAGCTTTTCCACACTGAGGG + Intergenic
1054375085 9:64443598-64443620 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1054377600 9:64461216-64461238 CTGTAGCTTTTCCATACTGAGGG + Intergenic
1054518161 9:66055095-66055117 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1054521657 9:66078910-66078932 CTGTAGCTTTTCCATACTGAGGG + Intergenic
1054521827 9:66080227-66080249 CTGTAGCTTTTCCACACTGAGGG - Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1054956319 9:70914859-70914881 CTGTAGTTCTTGCAAACTCATGG - Intronic
1055174308 9:73298963-73298985 CTGGAGCTTTTCCAGGCTCATGG + Intergenic
1056585854 9:87926679-87926701 CTGTAGCCTTTCCATACTGAGGG - Intergenic
1056611030 9:88126264-88126286 CTGTAGCCTTTCCATACTGAGGG + Intergenic
1057161547 9:92892151-92892173 CTGTAGCTTTTCCACACTGAGGG - Intergenic
1057675674 9:97134382-97134404 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1057676555 9:97140564-97140586 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1057677415 9:97146760-97146782 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1062612091 9:137379968-137379990 CTGCACCCCTGCCAGCCTCAGGG + Intronic
1203545350 Un_KI270743v1:124050-124072 CTGTAGCATTTCCATACTAAGGG + Intergenic
1185454279 X:300230-300252 CTGGAGCCCTTACAGACCCAGGG + Exonic
1187843228 X:23509913-23509935 CTGTAGCCTTTCCAGGTGCAGGG - Intergenic
1188909546 X:35829656-35829678 CTGTAGGCCTTGGAGAGTCATGG - Intergenic
1189259546 X:39668752-39668774 CTGCTGCCCTGGCAGACTCACGG - Intergenic
1189640926 X:43069019-43069041 CTGTGGTTCTTGCAGACTCATGG - Intergenic
1189690438 X:43612353-43612375 CTGTGGTTCTTGCAGACTCATGG + Intergenic
1190269623 X:48852642-48852664 CTGTGGCTTTTCCAGGCTCATGG + Intergenic
1191802180 X:65093421-65093443 CTGTAGCTTTTCCAGGCACAAGG - Intergenic
1192229459 X:69255145-69255167 CTGTGTTCCTTCCTGACTCAGGG - Intergenic
1192937018 X:75870901-75870923 CTGTAGCTTTTCCAGATGCAGGG - Intergenic
1193273380 X:79555098-79555120 CTGCAGCTTTTCCAGGCTCATGG - Intergenic
1193911233 X:87309295-87309317 CTGTAGCTTTTCCAGGCTCATGG + Intergenic
1194019467 X:88668959-88668981 CTGTGGCCTTTCCAGGTTCAAGG + Intergenic
1194147663 X:90282688-90282710 CTTTAGCCCTACCACTCTCATGG + Intergenic
1194893317 X:99406991-99407013 CTGCAGCTTTTCCAGGCTCATGG - Intergenic
1195035144 X:100965477-100965499 CTGTAGCTTTTTCAGGCTCAAGG - Intergenic
1197011697 X:121571490-121571512 CTGTGGTCCTTGCAGACTTATGG - Intergenic
1197046692 X:122006025-122006047 CTTAAGCCCTTCAAGATTCATGG - Intergenic
1197449434 X:126593764-126593786 CTGTGGTTCTTGCAGACTCATGG + Intergenic
1197493842 X:127153313-127153335 CTGTAGGGCTTCCAGATTCTTGG + Intergenic
1197856549 X:130919356-130919378 CTGCAGCTTTTCCAGGCTCACGG + Intergenic
1197975713 X:132163682-132163704 CTGCAGCTTTTCCAGACACATGG - Intergenic
1197987016 X:132277861-132277883 CTGTGGTTCTTGCAGACTCATGG + Intergenic
1199373812 X:147083705-147083727 CTGCAGCCCTTCCAGGTGCATGG - Intergenic
1199568639 X:149245683-149245705 CTGTGGCTCTTGCAGACTTATGG + Intergenic
1199931791 X:152530705-152530727 CTGTGGCTTTTCCAGGCTCATGG + Intergenic