ID: 1007792255

View in Genome Browser
Species Human (GRCh38)
Location 6:44317160-44317182
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 8, 1: 7, 2: 3, 3: 5, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007792249_1007792255 11 Left 1007792249 6:44317126-44317148 CCTTGGGATGCTGTTAATCTAGA 0: 2
1: 471
2: 165
3: 603
4: 567
Right 1007792255 6:44317160-44317182 AACCCCGTGCTCTCTGAAACAGG 0: 8
1: 7
2: 3
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905209972 1:36367306-36367328 AACCCCCTGCTTTCAGAATCAGG - Intronic
905316054 1:37081831-37081853 AACCCTGTGCTCTCTGAAACAGG + Intergenic
907376916 1:54052002-54052024 ACCTCCTTGCTCTCTAAAACTGG - Intronic
908161778 1:61416460-61416482 AACCCCATGCTCTCTGTGAGGGG - Intronic
912197020 1:107409981-107410003 ATTCCCGTGCCCTCTGGAACAGG - Intronic
914436901 1:147668705-147668727 TACCACTTGCTCTCTGGAACCGG - Intronic
915015232 1:152726768-152726790 AACCATGTACTCTCTGAGACAGG - Intergenic
915208502 1:154288116-154288138 AACCCTGTGCTCTCTGAAACAGG + Intergenic
917496140 1:175541782-175541804 CACCCCTGGCTCTATGAAACTGG + Intronic
920811706 1:209291986-209292008 AGCCCCGTGCTGTGGGAAACAGG + Intergenic
922241253 1:223756736-223756758 AACCCCTCCGTCTCTGAAACAGG + Intronic
1064720518 10:18224641-18224663 AACCTCCTACTCTCTGACACAGG - Intronic
1066635248 10:37493460-37493482 AACCCTGTGCTCACAGAGACAGG + Intergenic
1073574843 10:104613762-104613784 AAGCCCAGGCTCTCTGAAAGGGG + Intergenic
1075220302 10:120578890-120578912 AGCCCAGTGCCCTCTCAAACAGG + Intronic
1076053018 10:127350312-127350334 CACCCCCTGGTCTCTCAAACAGG + Intronic
1077367408 11:2166756-2166778 AAGCCCGTGCGCTCTGCAAGGGG + Exonic
1077839791 11:5961452-5961474 AACCCTGTGCTCTCTGAAACAGG + Intergenic
1078824181 11:14911928-14911950 AATACTGTGCTCTCTGAAATGGG + Intronic
1089560815 11:119342273-119342295 AACCCCCTGCTCTGTGTAAGAGG + Intronic
1104972117 12:132535591-132535613 CACCTCCTGCTCTCTGATACTGG - Intronic
1113509136 13:110838057-110838079 AACTCTGTGCTCGCAGAAACAGG - Intergenic
1114336745 14:21698280-21698302 AACCCCGTGCTCTCTGAAACAGG + Intergenic
1115812649 14:37127047-37127069 AACCCAGTGCTCTCAGAACCAGG - Intronic
1122261115 14:100523608-100523630 AACCCCGTGCACTCTGGAAGTGG + Intronic
1122641954 14:103165149-103165171 AACCTCTTGCTCTCTGCAAACGG - Intergenic
1133003543 16:2864253-2864275 AATCCCATGCCCTCTGATACTGG + Intergenic
1133054803 16:3140570-3140592 AACCCAGGGCTTTCTGAACCTGG + Intronic
1136519176 16:30785392-30785414 CACCTCGTGCTCTCAGAGACAGG - Intronic
1139493446 16:67299573-67299595 CACCCCTTTCTCTCTGACACAGG - Exonic
1142137260 16:88457150-88457172 AACCCAGCCCTCTCTGGAACTGG - Intronic
1143304291 17:5933587-5933609 AAGTCCCTTCTCTCTGAAACTGG + Intronic
1146886502 17:36474512-36474534 AACCTCTTGCTCTCTGTAAATGG + Intergenic
1150820574 17:68431139-68431161 ACACCCGTGCTCTCTCAATCTGG - Intronic
1151827481 17:76531268-76531290 AACCCCGTGCTCTCAGGACAAGG + Intronic
1152115557 17:78384836-78384858 AAACACGTGTTCTCTGACACCGG + Intronic
1158538981 18:58335413-58335435 GACCCCCTGCTGTCTGAATCAGG - Intronic
1160557434 18:79735349-79735371 AGCCCCGTGGTCCCTGAGACAGG - Intronic
1162199138 19:9008658-9008680 AGCCCAGTCCTCCCTGAAACAGG + Intergenic
1163865604 19:19770523-19770545 AACCCCGTGCTCTCTGAAACAGG + Intergenic
1163921874 19:20296919-20296941 ACCCCTGTGCTCTCTGAAACAGG + Intergenic
1165652379 19:37502561-37502583 AACCCTGTGCTTGCAGAAACAGG - Intergenic
1167453155 19:49584065-49584087 AATTCTGTGCTCTCTGAAGCTGG + Intronic
928674069 2:33633232-33633254 AACCCCCTACTCACTGAAGCAGG - Intergenic
929270311 2:39964559-39964581 AACCCAGTGCTCTCTGCTACTGG - Intergenic
930041635 2:47129550-47129572 AACACCGTGCTGCCTGTAACAGG - Intronic
930089247 2:47519935-47519957 AACCCCATGATCTCTTAAAGGGG + Exonic
936154554 2:110039719-110039741 ACCCCTCTTCTCTCTGAAACAGG - Intergenic
936190129 2:110331695-110331717 ACCCCTCTTCTCTCTGAAACAGG + Intergenic
938786604 2:134635712-134635734 CACCCTCTGCTCTCTGAAGCTGG - Intronic
940165419 2:150765152-150765174 AACCCCGTTCTCTCTGCTGCTGG + Intergenic
1169264319 20:4158375-4158397 AGCCCAGTGCTCTCTAAATCTGG + Intronic
1172279725 20:33700411-33700433 AACCCTGTGCTCTCTGAAACAGG + Intergenic
1173349802 20:42234164-42234186 AACCCTGTGGTTTCTGAAAGGGG + Intronic
1174528150 20:51190063-51190085 ACTCCAGTGCTCTCTGGAACAGG - Intergenic
1175770361 20:61619639-61619661 GACCCTGTGCTCTCTGAGAATGG - Intronic
1179095623 21:38312038-38312060 AACCACCTGATCTCTGAGACAGG + Intergenic
1181534847 22:23536197-23536219 AACCCTGTGCTCACAGAAACAGG + Intergenic
951729905 3:25798864-25798886 ATCCCAGTGCTCTATGATACAGG - Intergenic
953395149 3:42563247-42563269 AACCCACAGCTCTCTGAAGCTGG - Intronic
959069836 3:101692028-101692050 AACCCCGTGCTCTCTGAAACAGG + Intergenic
959070739 3:101700182-101700204 AACCCCGTGCTCTCTGAAACAGG + Intergenic
959071341 3:101704644-101704666 AACCCCGTGCTCTCTGAGACAGG - Intergenic
959985314 3:112564890-112564912 AACCCTGTGCTCCCTGAAACAGG - Intronic
966500290 3:180631928-180631950 AAGTCCGTTGTCTCTGAAACAGG - Intronic
966784784 3:183613421-183613443 AACCCAGTTCTCTCTGACTCCGG + Intergenic
969870994 4:10104818-10104840 AACCAAGTGCTCTTTGAAAGAGG + Intronic
979899072 4:126194764-126194786 AACCCTGTTCCCTCTCAAACAGG + Intergenic
981543379 4:145869572-145869594 TGCCCTGTCCTCTCTGAAACAGG - Intronic
983867571 4:172787319-172787341 AACCCTGATCTATCTGAAACTGG - Intronic
984597221 4:181683784-181683806 GACCCTGTGCTGTCTGAGACAGG + Intergenic
985617422 5:932011-932033 AACCCCATGCTCTCTTGAAGCGG - Intergenic
986504021 5:8430305-8430327 ACCCCCGTGCTCTCAGGAGCCGG - Intergenic
989803079 5:45568952-45568974 TACCCCTTTCTCTCTGAAGCAGG + Intronic
992443322 5:76813373-76813395 AACCCTGTGCTCTCTGAAACAGG + Intergenic
993033441 5:82730653-82730675 CAACCCTTACTCTCTGAAACTGG + Intergenic
993349264 5:86826915-86826937 AAGCCCGTGCTATCTGAAATAGG + Intergenic
993639843 5:90389255-90389277 ACCACTGTGCTCTCTGAAAAGGG - Intergenic
1002241686 5:177846752-177846774 CACCCCGTCCTCTCTGCCACTGG - Intergenic
1002389862 5:178901430-178901452 AGGGCCTTGCTCTCTGAAACTGG + Intronic
1007493804 6:42245086-42245108 AACCCAGGGCTCTCTGGGACGGG - Intronic
1007792255 6:44317160-44317182 AACCCCGTGCTCTCTGAAACAGG + Intronic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1019536770 7:1533484-1533506 AACCACGTGCTCTCTGCAGATGG + Intronic
1032551708 7:132790714-132790736 ATCTTCGTGCTCTCTGAAAGTGG + Intronic
1032570034 7:132986108-132986130 AACCCTGTGCTCTCTGAAACAGG + Intronic
1033294235 7:140115498-140115520 AACCCCGTGCTCTCTGAAACAGG + Intronic
1043341050 8:79240110-79240132 GACCCAGTGCACCCTGAAACTGG - Intergenic
1044257364 8:90081709-90081731 AAAACCTTGCTATCTGAAACTGG - Intronic
1049405239 8:142449471-142449493 AATCTCTCGCTCTCTGAAACTGG - Exonic
1058375554 9:104317121-104317143 AACCCATTGCTCTCTGAAACTGG + Intergenic
1189350331 X:40271000-40271022 CACCCCGTTCTCTCTTAAAAGGG - Intergenic
1195675548 X:107504761-107504783 AGCCCTGTGCTTTCTGAAATGGG + Intergenic
1195722220 X:107878045-107878067 AACCCCTTGCTCTATGCAAATGG + Intronic
1196343125 X:114620307-114620329 AACCTCGTGCTGCATGAAACAGG - Intronic
1201440218 Y:14000682-14000704 AACCCCGTGCTCTCTGAAACAGG - Intergenic
1201444353 Y:14042026-14042048 AACCCCGTGCTCTCTGAAACAGG + Intergenic