ID: 1007794560

View in Genome Browser
Species Human (GRCh38)
Location 6:44337322-44337344
Sequence CTATTTACAGAGGTGAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007794555_1007794560 10 Left 1007794555 6:44337289-44337311 CCAGCTGAGTAACTGCAGGGTAT 0: 1
1: 0
2: 1
3: 4
4: 97
Right 1007794560 6:44337322-44337344 CTATTTACAGAGGTGAAGGTGGG No data
1007794553_1007794560 13 Left 1007794553 6:44337286-44337308 CCTCCAGCTGAGTAACTGCAGGG 0: 1
1: 0
2: 2
3: 14
4: 174
Right 1007794560 6:44337322-44337344 CTATTTACAGAGGTGAAGGTGGG No data
1007794551_1007794560 14 Left 1007794551 6:44337285-44337307 CCCTCCAGCTGAGTAACTGCAGG 0: 1
1: 0
2: 4
3: 15
4: 171
Right 1007794560 6:44337322-44337344 CTATTTACAGAGGTGAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007794560 Original CRISPR CTATTTACAGAGGTGAAGGT GGG Intronic
No off target data available for this crispr