ID: 1007807034

View in Genome Browser
Species Human (GRCh38)
Location 6:44458129-44458151
Sequence TTGTTGTTCTAAAGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007807028_1007807034 12 Left 1007807028 6:44458094-44458116 CCTGGACTGGGCAGGTGGTGCAT No data
Right 1007807034 6:44458129-44458151 TTGTTGTTCTAAAGGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007807034 Original CRISPR TTGTTGTTCTAAAGGGCAGA TGG Intergenic
No off target data available for this crispr