ID: 1007807629

View in Genome Browser
Species Human (GRCh38)
Location 6:44462450-44462472
Sequence CCCGGGTCATCCCCTACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007807618_1007807629 27 Left 1007807618 6:44462400-44462422 CCCACGCGATGGAGGACTGTGCT No data
Right 1007807629 6:44462450-44462472 CCCGGGTCATCCCCTACTCCAGG No data
1007807623_1007807629 0 Left 1007807623 6:44462427-44462449 CCGCCCTCAGGGTGAGAGTGCTT No data
Right 1007807629 6:44462450-44462472 CCCGGGTCATCCCCTACTCCAGG No data
1007807625_1007807629 -4 Left 1007807625 6:44462431-44462453 CCTCAGGGTGAGAGTGCTTCCCG No data
Right 1007807629 6:44462450-44462472 CCCGGGTCATCCCCTACTCCAGG No data
1007807624_1007807629 -3 Left 1007807624 6:44462430-44462452 CCCTCAGGGTGAGAGTGCTTCCC No data
Right 1007807629 6:44462450-44462472 CCCGGGTCATCCCCTACTCCAGG No data
1007807619_1007807629 26 Left 1007807619 6:44462401-44462423 CCACGCGATGGAGGACTGTGCTG No data
Right 1007807629 6:44462450-44462472 CCCGGGTCATCCCCTACTCCAGG No data
1007807622_1007807629 3 Left 1007807622 6:44462424-44462446 CCTCCGCCCTCAGGGTGAGAGTG No data
Right 1007807629 6:44462450-44462472 CCCGGGTCATCCCCTACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007807629 Original CRISPR CCCGGGTCATCCCCTACTCC AGG Intergenic
No off target data available for this crispr