ID: 1007810296

View in Genome Browser
Species Human (GRCh38)
Location 6:44480857-44480879
Sequence ACCATAGGTTCCCCCAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007810296_1007810307 9 Left 1007810296 6:44480857-44480879 CCAGCCTTGGGGGAACCTATGGT No data
Right 1007810307 6:44480889-44480911 GGCAGTTGGAGGTGAGGGAGTGG No data
1007810296_1007810310 28 Left 1007810296 6:44480857-44480879 CCAGCCTTGGGGGAACCTATGGT No data
Right 1007810310 6:44480908-44480930 GTGGGAAGAGATTCCGAGTAGGG No data
1007810296_1007810311 29 Left 1007810296 6:44480857-44480879 CCAGCCTTGGGGGAACCTATGGT No data
Right 1007810311 6:44480909-44480931 TGGGAAGAGATTCCGAGTAGGGG No data
1007810296_1007810309 27 Left 1007810296 6:44480857-44480879 CCAGCCTTGGGGGAACCTATGGT No data
Right 1007810309 6:44480907-44480929 AGTGGGAAGAGATTCCGAGTAGG No data
1007810296_1007810308 10 Left 1007810296 6:44480857-44480879 CCAGCCTTGGGGGAACCTATGGT No data
Right 1007810308 6:44480890-44480912 GCAGTTGGAGGTGAGGGAGTGGG No data
1007810296_1007810303 -5 Left 1007810296 6:44480857-44480879 CCAGCCTTGGGGGAACCTATGGT No data
Right 1007810303 6:44480875-44480897 ATGGTAGGGATCTGGGCAGTTGG No data
1007810296_1007810306 4 Left 1007810296 6:44480857-44480879 CCAGCCTTGGGGGAACCTATGGT No data
Right 1007810306 6:44480884-44480906 ATCTGGGCAGTTGGAGGTGAGGG No data
1007810296_1007810304 -2 Left 1007810296 6:44480857-44480879 CCAGCCTTGGGGGAACCTATGGT No data
Right 1007810304 6:44480878-44480900 GTAGGGATCTGGGCAGTTGGAGG No data
1007810296_1007810305 3 Left 1007810296 6:44480857-44480879 CCAGCCTTGGGGGAACCTATGGT No data
Right 1007810305 6:44480883-44480905 GATCTGGGCAGTTGGAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007810296 Original CRISPR ACCATAGGTTCCCCCAAGGC TGG (reversed) Intergenic
No off target data available for this crispr