ID: 1007814583

View in Genome Browser
Species Human (GRCh38)
Location 6:44512141-44512163
Sequence CTACTGGTTTTGAGGATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007814577_1007814583 12 Left 1007814577 6:44512106-44512128 CCTACAGAGAATTCTCAACACTT No data
Right 1007814583 6:44512141-44512163 CTACTGGTTTTGAGGATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007814583 Original CRISPR CTACTGGTTTTGAGGATAAA TGG Intergenic
No off target data available for this crispr