ID: 1007815930

View in Genome Browser
Species Human (GRCh38)
Location 6:44525557-44525579
Sequence TTCCAGTGGAAGCCAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007815930_1007815933 -10 Left 1007815930 6:44525557-44525579 CCCTGGCCTGGCTTCCACTGGAA No data
Right 1007815933 6:44525570-44525592 TCCACTGGAAATAAAATCACAGG No data
1007815930_1007815935 -9 Left 1007815930 6:44525557-44525579 CCCTGGCCTGGCTTCCACTGGAA No data
Right 1007815935 6:44525571-44525593 CCACTGGAAATAAAATCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007815930 Original CRISPR TTCCAGTGGAAGCCAGGCCA GGG (reversed) Intergenic
No off target data available for this crispr