ID: 1007816119

View in Genome Browser
Species Human (GRCh38)
Location 6:44526838-44526860
Sequence CCTAATAACCCCATTCATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007816119_1007816123 0 Left 1007816119 6:44526838-44526860 CCTTAATGAATGGGGTTATTAGG No data
Right 1007816123 6:44526861-44526883 GTTTAAGAGAATGAGGTCATTGG No data
1007816119_1007816125 2 Left 1007816119 6:44526838-44526860 CCTTAATGAATGGGGTTATTAGG No data
Right 1007816125 6:44526863-44526885 TTAAGAGAATGAGGTCATTGGGG No data
1007816119_1007816127 21 Left 1007816119 6:44526838-44526860 CCTTAATGAATGGGGTTATTAGG No data
Right 1007816127 6:44526882-44526904 GGGGTTTATTAAACCATCAAGGG No data
1007816119_1007816122 -7 Left 1007816119 6:44526838-44526860 CCTTAATGAATGGGGTTATTAGG No data
Right 1007816122 6:44526854-44526876 TATTAGGGTTTAAGAGAATGAGG No data
1007816119_1007816124 1 Left 1007816119 6:44526838-44526860 CCTTAATGAATGGGGTTATTAGG No data
Right 1007816124 6:44526862-44526884 TTTAAGAGAATGAGGTCATTGGG No data
1007816119_1007816126 20 Left 1007816119 6:44526838-44526860 CCTTAATGAATGGGGTTATTAGG No data
Right 1007816126 6:44526881-44526903 TGGGGTTTATTAAACCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007816119 Original CRISPR CCTAATAACCCCATTCATTA AGG (reversed) Intergenic
No off target data available for this crispr