ID: 1007816123

View in Genome Browser
Species Human (GRCh38)
Location 6:44526861-44526883
Sequence GTTTAAGAGAATGAGGTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007816119_1007816123 0 Left 1007816119 6:44526838-44526860 CCTTAATGAATGGGGTTATTAGG No data
Right 1007816123 6:44526861-44526883 GTTTAAGAGAATGAGGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007816123 Original CRISPR GTTTAAGAGAATGAGGTCAT TGG Intergenic
No off target data available for this crispr